ID: 913665922

View in Genome Browser
Species Human (GRCh38)
Location 1:121048845-121048867
Sequence CAGAATATACAATCGAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913665920_913665922 26 Left 913665920 1:121048796-121048818 CCCAGGGCGCTCAATTAGGACTT No data
Right 913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG No data
913665921_913665922 25 Left 913665921 1:121048797-121048819 CCAGGGCGCTCAATTAGGACTTG No data
Right 913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913665922 Original CRISPR CAGAATATACAATCGAACAA TGG Intergenic
No off target data available for this crispr