ID: 913665922 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:121048845-121048867 |
| Sequence | CAGAATATACAATCGAACAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 913665920_913665922 | 26 | Left | 913665920 | 1:121048796-121048818 | CCCAGGGCGCTCAATTAGGACTT | No data | ||
| Right | 913665922 | 1:121048845-121048867 | CAGAATATACAATCGAACAATGG | No data | ||||
| 913665921_913665922 | 25 | Left | 913665921 | 1:121048797-121048819 | CCAGGGCGCTCAATTAGGACTTG | No data | ||
| Right | 913665922 | 1:121048845-121048867 | CAGAATATACAATCGAACAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 913665922 | Original CRISPR | CAGAATATACAATCGAACAA TGG | Intergenic | ||
| No off target data available for this crispr | |||||