ID: 913666956

View in Genome Browser
Species Human (GRCh38)
Location 1:121057560-121057582
Sequence CTGTGGTTGTGCAGCAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913666950_913666956 2 Left 913666950 1:121057535-121057557 CCAGCATGAGCTGAGCCTCCTCA No data
Right 913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG No data
913666944_913666956 28 Left 913666944 1:121057509-121057531 CCCATTGACACTGTTCCCAATTC No data
Right 913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG No data
913666946_913666956 13 Left 913666946 1:121057524-121057546 CCCAATTCCCTCCAGCATGAGCT No data
Right 913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG No data
913666945_913666956 27 Left 913666945 1:121057510-121057532 CCATTGACACTGTTCCCAATTCC No data
Right 913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG No data
913666948_913666956 6 Left 913666948 1:121057531-121057553 CCCTCCAGCATGAGCTGAGCCTC No data
Right 913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG No data
913666947_913666956 12 Left 913666947 1:121057525-121057547 CCAATTCCCTCCAGCATGAGCTG No data
Right 913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG No data
913666949_913666956 5 Left 913666949 1:121057532-121057554 CCTCCAGCATGAGCTGAGCCTCC No data
Right 913666956 1:121057560-121057582 CTGTGGTTGTGCAGCAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913666956 Original CRISPR CTGTGGTTGTGCAGCAGACA GGG Intergenic
No off target data available for this crispr