ID: 913672786

View in Genome Browser
Species Human (GRCh38)
Location 1:121113690-121113712
Sequence CTGGGTCAGGGCATTGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913672786_913672795 12 Left 913672786 1:121113690-121113712 CCAATCTCAATGCCCTGACCCAG No data
Right 913672795 1:121113725-121113747 TCTACATGTGCAGTGTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913672786 Original CRISPR CTGGGTCAGGGCATTGAGAT TGG (reversed) Intergenic
No off target data available for this crispr