ID: 913675816

View in Genome Browser
Species Human (GRCh38)
Location 1:121139155-121139177
Sequence TGACTTTGAAGGTGCTGTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913675816_913675820 0 Left 913675816 1:121139155-121139177 CCAAAACAGCACCTTCAAAGTCA No data
Right 913675820 1:121139178-121139200 GGAGCTACATGGAAACAGAATGG No data
913675816_913675821 27 Left 913675816 1:121139155-121139177 CCAAAACAGCACCTTCAAAGTCA No data
Right 913675821 1:121139205-121139227 CATCAGCTAAAAGATACCCTAGG No data
913675816_913675822 28 Left 913675816 1:121139155-121139177 CCAAAACAGCACCTTCAAAGTCA No data
Right 913675822 1:121139206-121139228 ATCAGCTAAAAGATACCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913675816 Original CRISPR TGACTTTGAAGGTGCTGTTT TGG (reversed) Intergenic
No off target data available for this crispr