ID: 913675818

View in Genome Browser
Species Human (GRCh38)
Location 1:121139166-121139188
Sequence CATGTAGCTCCTGACTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913675818_913675821 16 Left 913675818 1:121139166-121139188 CCTTCAAAGTCAGGAGCTACATG No data
Right 913675821 1:121139205-121139227 CATCAGCTAAAAGATACCCTAGG No data
913675818_913675822 17 Left 913675818 1:121139166-121139188 CCTTCAAAGTCAGGAGCTACATG No data
Right 913675822 1:121139206-121139228 ATCAGCTAAAAGATACCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913675818 Original CRISPR CATGTAGCTCCTGACTTTGA AGG (reversed) Intergenic