ID: 913675821

View in Genome Browser
Species Human (GRCh38)
Location 1:121139205-121139227
Sequence CATCAGCTAAAAGATACCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913675816_913675821 27 Left 913675816 1:121139155-121139177 CCAAAACAGCACCTTCAAAGTCA No data
Right 913675821 1:121139205-121139227 CATCAGCTAAAAGATACCCTAGG No data
913675818_913675821 16 Left 913675818 1:121139166-121139188 CCTTCAAAGTCAGGAGCTACATG No data
Right 913675821 1:121139205-121139227 CATCAGCTAAAAGATACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913675821 Original CRISPR CATCAGCTAAAAGATACCCT AGG Intergenic
No off target data available for this crispr