ID: 913681287

View in Genome Browser
Species Human (GRCh38)
Location 1:121188306-121188328
Sequence ATGTGGACTAGGAGAAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913681277_913681287 18 Left 913681277 1:121188265-121188287 CCCCATTTCCCTCTCCTGAAAAA No data
Right 913681287 1:121188306-121188328 ATGTGGACTAGGAGAAACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 180
913681282_913681287 9 Left 913681282 1:121188274-121188296 CCTCTCCTGAAAAATGTGAAGGG No data
Right 913681287 1:121188306-121188328 ATGTGGACTAGGAGAAACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 180
913681279_913681287 16 Left 913681279 1:121188267-121188289 CCATTTCCCTCTCCTGAAAAATG 0: 4
1: 0
2: 6
3: 70
4: 655
Right 913681287 1:121188306-121188328 ATGTGGACTAGGAGAAACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 180
913681284_913681287 4 Left 913681284 1:121188279-121188301 CCTGAAAAATGTGAAGGGTAAAG 0: 4
1: 0
2: 2
3: 22
4: 287
Right 913681287 1:121188306-121188328 ATGTGGACTAGGAGAAACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 180
913681280_913681287 10 Left 913681280 1:121188273-121188295 CCCTCTCCTGAAAAATGTGAAGG 0: 4
1: 1
2: 4
3: 28
4: 289
Right 913681287 1:121188306-121188328 ATGTGGACTAGGAGAAACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 180
913681278_913681287 17 Left 913681278 1:121188266-121188288 CCCATTTCCCTCTCCTGAAAAAT 0: 4
1: 0
2: 5
3: 66
4: 497
Right 913681287 1:121188306-121188328 ATGTGGACTAGGAGAAACCAAGG 0: 1
1: 0
2: 0
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913681287 Original CRISPR ATGTGGACTAGGAGAAACCA AGG Intronic
902191583 1:14766936-14766958 ATGTGGTCTAGGGGAAAATAAGG + Intronic
902822682 1:18953038-18953060 AGGTGGACCAGGGGAAACCCTGG + Intronic
902901584 1:19520329-19520351 ATGTGTACTAATAGAATCCATGG + Intergenic
905050523 1:35047122-35047144 ATGTGGTCAAGGCCAAACCAGGG - Intergenic
906824661 1:48966171-48966193 ATTTGGATTAGAAGAAAGCATGG - Intronic
913681287 1:121188306-121188328 ATGTGGACTAGGAGAAACCAAGG + Intronic
915007917 1:152657252-152657274 ATTTGGACTCAGGGAAACCATGG - Intergenic
921114816 1:212079530-212079552 ATTTGGAATAGGAGAAAGCTGGG + Intronic
921303333 1:213771277-213771299 ATGTGTCCTAGAAGAAATCAAGG + Intergenic
921368752 1:214400526-214400548 ATGTGGACTGCGAGAAACAGGGG - Intronic
921627951 1:217399385-217399407 ATGGGAGCTAGCAGAAACCATGG - Intergenic
921754455 1:218837715-218837737 ATGTGTACAGTGAGAAACCATGG + Intergenic
1062939106 10:1408769-1408791 CTGTGGACTGAGAGAGACCACGG + Intronic
1065641574 10:27787641-27787663 CTCTGGACTAGGAGAAGACATGG - Intergenic
1066447463 10:35496686-35496708 AAATGGAAGAGGAGAAACCAAGG + Intronic
1067524541 10:47030212-47030234 ATCTGGACTAGGAAACCCCATGG - Intergenic
1068891426 10:62152104-62152126 ATATGGCCTAGGAAATACCATGG - Intergenic
1069153754 10:64999241-64999263 ATGTGGCCTAGGACAAGACAGGG + Intergenic
1070375665 10:75828903-75828925 ATGTGGAATTGGGGAAACAAGGG + Intronic
1070542384 10:77425516-77425538 ATGAGGACAAGGAGAAGGCAGGG - Intronic
1073633047 10:105167878-105167900 GTGGGTACAAGGAGAAACCAGGG + Intronic
1073653358 10:105385257-105385279 ATTTAGACTAGGAAAATCCATGG + Intergenic
1074567161 10:114590573-114590595 ATGTGAATAAGGAGAAACCCAGG + Intronic
1074791278 10:116889946-116889968 ATGAGGCCTAGGAGAAAGAAAGG - Intronic
1075444591 10:122504665-122504687 ATGTGCACTAGGCCACACCAGGG - Intronic
1075866172 10:125720905-125720927 AAGTGGAGAAGCAGAAACCAAGG - Intronic
1077921995 11:6648173-6648195 ATGTGGATTTGGACAAATCATGG + Intronic
1078135868 11:8650984-8651006 ATTTGGACTAGGAGAGGCCTAGG - Intronic
1079384757 11:19968918-19968940 CTGCGGACAAGGAGAAGCCAAGG - Intronic
1081763195 11:45591436-45591458 ATGTGGACAGGGAGAAGGCAAGG - Intergenic
1084053313 11:66615334-66615356 ATGAGGACTTGGAGTAATCAAGG - Intergenic
1085955940 11:81395170-81395192 ATGTGGACAGGGAGAAACAAAGG + Intergenic
1086767265 11:90712291-90712313 ATGTGGACAAGTGGAAACCCTGG - Intergenic
1087277999 11:96179694-96179716 ATGTGGTCTAGGAGGGACCTGGG + Intronic
1087892040 11:103546490-103546512 ATGTGGAATGAGAGATACCAGGG - Intergenic
1091651263 12:2311985-2312007 ATGTAAACTAGGAGAACCCCTGG + Intronic
1094342875 12:29432394-29432416 ATGTGGAATGTGAGAAATCAAGG + Intronic
1095112403 12:38312465-38312487 ATGAAGAATTGGAGAAACCAGGG + Intergenic
1095122514 12:38436588-38436610 ATGAGATCTAGGAGGAACCAGGG - Intergenic
1095286374 12:40415820-40415842 ATTTGGACTTGGAGAAACGAAGG + Intronic
1095634487 12:44416782-44416804 TTGAGAACTGGGAGAAACCAAGG - Intergenic
1096175423 12:49513712-49513734 AAGTGGACTTGGTGCAACCATGG + Intronic
1096646953 12:53044046-53044068 ATGTGGACTGGGAGACACACGGG - Intergenic
1098232996 12:68391778-68391800 ATCAGGACTGGGAGGAACCATGG + Intergenic
1098270100 12:68761816-68761838 ATGTGGAGAAAGAGAAAACAAGG + Intronic
1099625378 12:85066099-85066121 ATGTGTACTGGGAGCTACCAAGG + Intronic
1100235624 12:92657881-92657903 ATCTGTAATAGCAGAAACCAGGG - Intergenic
1100651325 12:96591931-96591953 ATGTGAACAAGGAGACATCAGGG + Intronic
1100700669 12:97144482-97144504 ATGTGACCTAGGAGAGAGCAGGG - Intergenic
1102023164 12:109697946-109697968 ATGCTGCCTAGGAGAAGCCAGGG - Intergenic
1103178686 12:118888478-118888500 ATGTGGACTTGGAGAAATCTGGG - Intergenic
1106634612 13:31514524-31514546 ATGTCGAATAGGAGAAAAAAGGG + Intergenic
1107335094 13:39346333-39346355 ATGTGGAAAGGGAGAAATCAAGG - Intronic
1107563465 13:41578302-41578324 ATCTGGAAGATGAGAAACCAGGG - Intronic
1112632407 13:101177010-101177032 AGGTGATCTAGGAGAGACCAAGG - Intronic
1114401315 14:22413482-22413504 AGATGGACTAGAAGAACCCAGGG - Intergenic
1115189563 14:30732692-30732714 TTGTGGACTAGTATAAACCAAGG - Intronic
1116427127 14:44805007-44805029 ATGTGGACAAAGAAACACCAGGG + Intergenic
1118391305 14:65298114-65298136 CTGTGGAATAGGAGCCACCAAGG - Intergenic
1119400782 14:74360765-74360787 ATGTGGGCCAGGAGAGACAATGG - Intergenic
1119430970 14:74567784-74567806 AGGAGGACTGGGAGAAGCCATGG - Intronic
1122406253 14:101502866-101502888 AGGTGGCCAAGGAGAAGCCAGGG - Intergenic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1127752878 15:62063426-62063448 AGGTTAACTAGGAGAAAGCACGG + Intergenic
1130677352 15:85965099-85965121 TTTGGGACTAGGAAAAACCAAGG - Intergenic
1132456818 16:28710-28732 ATGAGGACAAGGAGGAACGAGGG + Intergenic
1133593498 16:7268320-7268342 AAGTGGAAGTGGAGAAACCAAGG + Intronic
1135155863 16:20052067-20052089 ATGTGGGCTGAAAGAAACCACGG + Intronic
1137898192 16:52236817-52236839 ATGTGGCCTAGTAGAAACTGGGG + Intergenic
1138945801 16:61848344-61848366 ATGTCTATTTGGAGAAACCAAGG - Intronic
1140093949 16:71859619-71859641 AAGTGATCTAGGAGAAACCTGGG - Intronic
1140625585 16:76790130-76790152 ATGTGGTCCAGCATAAACCAAGG - Intergenic
1147199517 17:38790825-38790847 ATGTGGCCTAGTAGAAATGAGGG - Intronic
1148768030 17:50050728-50050750 CTGTGGAGTTGGAGAAACCTGGG + Intergenic
1148848624 17:50543320-50543342 ATGTGGAGTCTGGGAAACCAAGG + Exonic
1150450758 17:65265764-65265786 TAGTGGAGTAGGAGAAGCCATGG - Intergenic
1150736096 17:67740733-67740755 ATGTGGACTTGGAGAAATCTGGG + Intronic
1150964410 17:69951529-69951551 ATGAGGATTCAGAGAAACCAAGG - Intergenic
1163230333 19:15997591-15997613 ATGAGGACCATCAGAAACCATGG + Intergenic
1164464591 19:28476641-28476663 CTGTGGGCTGGGGGAAACCAAGG - Intergenic
925041618 2:735518-735540 ATGTGGACTAAGACAAGACAGGG + Intergenic
926719429 2:15948526-15948548 ATGGGGACTAGGAGAATTAAAGG - Intergenic
928610717 2:32989568-32989590 ATGTGGACAAGGAAAAGCCCAGG + Intronic
928994136 2:37268683-37268705 ATGTGCACTAGAAGAGACAAAGG + Intronic
929576480 2:43055815-43055837 ATGGGGCCAGGGAGAAACCAAGG + Intergenic
930157033 2:48116342-48116364 ATGAGGAGTAGGAGAAGTCATGG + Intergenic
930708580 2:54528801-54528823 CTGTGGTCTAGAAGAAACCAGGG + Intronic
931090347 2:58879020-58879042 ATGTGGGCAGGGAGAAATCAGGG + Intergenic
931933133 2:67163944-67163966 ATGTGGCCTGAGAGAACCCATGG - Intergenic
934759578 2:96846403-96846425 ACGTGGCCCAGGAGAAACCATGG + Intronic
939812520 2:146852107-146852129 ATGAGGACAAGGAGAGACAATGG - Intergenic
940815524 2:158293517-158293539 ATGGAGACTAAGAGAAGCCAAGG + Intronic
941149227 2:161893191-161893213 ATGTGGTCTAGAAGAAAACCTGG + Intronic
942745690 2:179229385-179229407 CTGAGGACTAGGAGCAACAATGG - Intronic
944478195 2:200128031-200128053 TTGAGGGATAGGAGAAACCAGGG - Intergenic
944866420 2:203866772-203866794 GTGTGGACAATGGGAAACCATGG + Intergenic
945523432 2:210858638-210858660 ATGGGGACTAAAAGAAGCCAAGG - Intergenic
947204940 2:227651877-227651899 TTGAGGACCAGGAGAGACCATGG + Intergenic
1169567114 20:6867207-6867229 ATGTAGACTAGCAGTCACCAAGG + Intergenic
1170369901 20:15637439-15637461 TTGAGAACTAGGAGAACCCAGGG + Intronic
1170714936 20:18823383-18823405 ATGAGGAGTAAGAGAAAGCACGG - Intronic
1174363610 20:50043322-50043344 ATGTGGATTGGGAGAGACCCTGG - Intergenic
1176148537 20:63576570-63576592 AGAGGCACTAGGAGAAACCAGGG + Intergenic
1177197480 21:17918565-17918587 ATGTGTCCTAGGAGGAACCCGGG - Intronic
1177216842 21:18141163-18141185 AGGTGGACTTGGAGTAATCATGG + Intronic
1179117173 21:38504163-38504185 ATCTGAACTAATAGAAACCAAGG + Intronic
1179601401 21:42480067-42480089 AGGTGGACCATGAGCAACCATGG + Intronic
1184137940 22:42560411-42560433 ATTTAGAGCAGGAGAAACCAAGG + Intronic
1185172310 22:49301241-49301263 AGGTGAAGAAGGAGAAACCAGGG - Intergenic
952283191 3:31943026-31943048 AAGTAGACTAGAAGATACCAAGG - Intronic
952738186 3:36710770-36710792 CTGTGGTCTAGTTGAAACCAAGG + Intergenic
953700616 3:45192907-45192929 ATGTGTACTAGGAGCATCTATGG - Intergenic
961150532 3:124634045-124634067 ATGTGGACGACGAGATAACATGG - Intronic
962538457 3:136353245-136353267 ATGTGTAATGGGAGTAACCAAGG + Intronic
964220446 3:154338438-154338460 ATTTGGCCTAGGAGAAACTGAGG - Intronic
964664063 3:159152459-159152481 GTCTGAACTAGGAGAGACCATGG + Intronic
965061235 3:163787934-163787956 ATCTGGACTAGGGGAAAGCAGGG + Intergenic
965403228 3:168238570-168238592 ATGTGGAACAGGAGAATCCATGG + Intergenic
967692107 3:192487382-192487404 GTGTGGTCTTGGAGAAACAACGG - Intronic
970258374 4:14195159-14195181 TTGTACACTAGGAGAAAGCATGG - Intergenic
973643919 4:52931404-52931426 TTCTGAACTAGGAGAAAACAAGG + Intronic
973846769 4:54920871-54920893 ATGTGAACTAGGAGAAGAGAAGG - Intergenic
974200544 4:58633726-58633748 ATGTGGACCAGAAGAAAGAAAGG + Intergenic
975011766 4:69364020-69364042 AAGTGGACTAGTAGATACCAGGG + Intronic
975743093 4:77449684-77449706 CCTTTGACTAGGAGAAACCAGGG - Intergenic
975881534 4:78914127-78914149 ATGAGGTCTAGCAGAGACCAAGG - Exonic
977144799 4:93425395-93425417 ATGTGGACTACGAAAACCAAGGG - Intronic
978266400 4:106831509-106831531 ATGTGGAAAAGCAGAAATCAGGG + Intergenic
979213449 4:118133998-118134020 CTGTGTACTATGAAAAACCAAGG + Intronic
981220678 4:142229982-142230004 ATTTAAACTAGAAGAAACCAAGG + Intronic
981849742 4:149216216-149216238 ATGAGGAACAGGAGAAAGCAAGG + Intergenic
982064351 4:151639921-151639943 ATGTGGACTAGGGGAAGACCAGG - Intronic
983739547 4:171111790-171111812 GTGTGGACTATGAAAGACCAAGG + Intergenic
984906338 4:184630286-184630308 ATGTGGAGTGGGAGAAAAGAAGG - Intronic
985522065 5:378587-378609 ATGTGCACCAGGGGAAGCCACGG - Intronic
987664778 5:20923101-20923123 ATGTGCACTAGGAGAGAAGATGG + Intergenic
987883073 5:23774974-23774996 ATCTGGATTTGGAGAAATCATGG - Intergenic
988757910 5:34279067-34279089 ATGTGCACTAGGAGACAAGATGG - Intergenic
989361991 5:40612349-40612371 ATTTGGACTAGTAGAAAAGAAGG + Intergenic
993139731 5:84016701-84016723 ATGAGGCCCAGGAGTAACCAGGG - Intronic
993557283 5:89356214-89356236 CTGAGGACTAGAAGAAACAATGG - Intergenic
994694917 5:103062245-103062267 ATGTAGTATAGGAGAAACCAGGG + Intergenic
995996009 5:118300249-118300271 TGTTGGACTAGGAGAAATCAAGG + Intergenic
996024585 5:118630638-118630660 ATGTAGAGGATGAGAAACCAAGG - Intergenic
997368773 5:133342724-133342746 ATGGGGACTATGAGAAAACTTGG + Intronic
1002957830 6:1885455-1885477 AGGAAGAGTAGGAGAAACCATGG + Intronic
1004948501 6:20642156-20642178 ATGTGTATTAGAAGAAAACATGG + Intronic
1005172294 6:23001995-23002017 TAGTGGACCAAGAGAAACCAGGG + Intergenic
1008465634 6:51827492-51827514 CTGTCGACTAGGATAAACCTGGG - Intronic
1008648891 6:53544322-53544344 ACGCGGACTAGGCGAAAGCAGGG + Intronic
1009284776 6:61803128-61803150 ATGAGGAGTAGGAGGAAGCAAGG - Intronic
1011147436 6:84234077-84234099 ATATGTACTAAAAGAAACCAGGG + Intergenic
1011580817 6:88862212-88862234 ATGGGGACTAGGAAAGAACATGG + Intronic
1018805172 6:167253664-167253686 ATGTGAACTTTGGGAAACCAGGG - Intergenic
1019940550 7:4285816-4285838 ATGTGGACCATGAGAACCCCTGG - Intergenic
1020601387 7:10278762-10278784 GTGATGACTAGAAGAAACCAAGG - Intergenic
1021267632 7:18544696-18544718 ATGTGGACTATTAGAAACTAAGG + Intronic
1022158122 7:27680727-27680749 ATGTGAACTAGGAGTAAGGAAGG + Intergenic
1024453751 7:49579769-49579791 GTGTGGGCTTAGAGAAACCAGGG + Intergenic
1026035225 7:66825613-66825635 CTGTGGACTAGGAGTGACCATGG + Intergenic
1026555738 7:71407297-71407319 AGGTGGCCTAGGAGGAACCCAGG + Intronic
1026984309 7:74545472-74545494 CTGTGGACTAGGAGTGACCATGG - Intronic
1029013653 7:97290667-97290689 ATGGGGACTGATAGAAACCATGG + Intergenic
1029192813 7:98783763-98783785 TTGTGGATTTGGAGAGACCAAGG - Intergenic
1030173490 7:106628004-106628026 ATATTGACTAGAAGAAAACAAGG + Intergenic
1031142249 7:117956299-117956321 ATAGGAACTAGCAGAAACCATGG + Intergenic
1032644096 7:133802122-133802144 ATGTGGTATAGAAGAAAGCATGG + Intronic
1034007850 7:147493886-147493908 ATATGGACAGGGAGAAATCAGGG + Intronic
1037182542 8:16024940-16024962 ATATGTACTGGGAGGAACCAGGG - Intergenic
1037567926 8:20133278-20133300 ATGTGGACAAGGGAAAAGCAGGG + Intergenic
1042438877 8:68801398-68801420 TTCTGGATTGGGAGAAACCATGG - Intronic
1044236302 8:89834701-89834723 ATGTAGAGTAGGGGAAACCACGG + Intergenic
1047449066 8:124946432-124946454 AAGGGGGCTAGGAGAAACCAGGG - Intergenic
1047619176 8:126588863-126588885 GTGTGGACAAGGAGGAACGAGGG - Intergenic
1048183058 8:132213951-132213973 ATGAGGACAAGAAAAAACCACGG + Intronic
1051666995 9:19474995-19475017 AAGTGTACTAGGAGAAAGAAAGG - Intergenic
1055539697 9:77290513-77290535 AAGTGGAGGAGGAGAAAACAGGG - Intronic
1057830355 9:98401541-98401563 TTGTGGACAAGCAGGAACCAGGG - Intronic
1059436932 9:114282598-114282620 ATGTGGAATAGAGGGAACCAAGG + Intronic
1061575389 9:131503052-131503074 GTGTGGACTCGGAGAAACGCGGG + Exonic
1062436317 9:136548017-136548039 CTGTGGCCGAGGAGAAGCCAGGG + Intergenic
1062583599 9:137238886-137238908 CTGGGCACTAGGAGAAACCTGGG + Intergenic
1186532280 X:10309587-10309609 ATCAGGATTAGGAGACACCATGG - Intergenic
1186680020 X:11862890-11862912 TTGTGGACTAGGACTAACTAAGG + Intergenic
1188810959 X:34654437-34654459 GTGTGGAGTAGCAGAAAACAGGG - Intronic
1189634520 X:42991677-42991699 ATGTGCACAAGGAGAATGCATGG + Intergenic
1189758441 X:44296212-44296234 ATGTGGAAAAGGAGAAAGCTGGG + Intronic
1191988570 X:67008671-67008693 ATTTGCACTAGGAGTAATCAAGG + Intergenic
1192896189 X:75444993-75445015 ATAAGCACTAGGAGAAACAATGG - Intronic
1194675240 X:96786093-96786115 AGGTAGAGTTGGAGAAACCAAGG + Intronic
1197889471 X:131254589-131254611 ATGTGGAGTAAAAGAAACAATGG - Intergenic
1198120912 X:133591660-133591682 ATGTGGACAAAGGGAAACCATGG + Intronic
1199920080 X:152391736-152391758 ATGTGCAAAAGGAAAAACCAAGG + Intronic
1200399542 X:156011013-156011035 ATGAGGACAAGGAGGAACGAGGG - Intergenic
1202273305 Y:23090993-23091015 ACATGGCCTAGGAGAAATCAAGG + Intergenic
1202292721 Y:23329689-23329711 ACATGGCCTAGGAGAAATCAAGG - Intergenic
1202426302 Y:24724737-24724759 ACATGGCCTAGGAGAAATCAAGG + Intergenic
1202444487 Y:24945349-24945371 ACATGGCCTAGGAGAAATCAAGG - Intergenic