ID: 913684877

View in Genome Browser
Species Human (GRCh38)
Location 1:121222264-121222286
Sequence GGTCAGGTTCAGCAGCCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 4, 1: 0, 2: 1, 3: 5, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913684877_913684881 17 Left 913684877 1:121222264-121222286 CCATAGGGCTGCTGAACCTGACC 0: 4
1: 0
2: 1
3: 5
4: 112
Right 913684881 1:121222304-121222326 ATGTTACTTCTTCCATTCCTTGG 0: 4
1: 0
2: 4
3: 21
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913684877 Original CRISPR GGTCAGGTTCAGCAGCCCTA TGG (reversed) Intronic