ID: 913686985

View in Genome Browser
Species Human (GRCh38)
Location 1:121241487-121241509
Sequence CATTGTAAAGGGAGTAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913686977_913686985 19 Left 913686977 1:121241445-121241467 CCTTTACAGAAGTTCATTATGAA 0: 4
1: 0
2: 1
3: 20
4: 195
Right 913686985 1:121241487-121241509 CATTGTAAAGGGAGTAGGGAAGG No data
913686975_913686985 21 Left 913686975 1:121241443-121241465 CCCCTTTACAGAAGTTCATTATG No data
Right 913686985 1:121241487-121241509 CATTGTAAAGGGAGTAGGGAAGG No data
913686979_913686985 -6 Left 913686979 1:121241470-121241492 CCCAAGGATGAAATCAACATTGT 0: 3
1: 0
2: 3
3: 29
4: 291
Right 913686985 1:121241487-121241509 CATTGTAAAGGGAGTAGGGAAGG No data
913686980_913686985 -7 Left 913686980 1:121241471-121241493 CCAAGGATGAAATCAACATTGTA No data
Right 913686985 1:121241487-121241509 CATTGTAAAGGGAGTAGGGAAGG No data
913686976_913686985 20 Left 913686976 1:121241444-121241466 CCCTTTACAGAAGTTCATTATGA 0: 4
1: 0
2: 1
3: 20
4: 237
Right 913686985 1:121241487-121241509 CATTGTAAAGGGAGTAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913686985 Original CRISPR CATTGTAAAGGGAGTAGGGA AGG Intronic
No off target data available for this crispr