ID: 913688727

View in Genome Browser
Species Human (GRCh38)
Location 1:121258144-121258166
Sequence CACAAGGAGGCAATTTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913688727_913688731 -5 Left 913688727 1:121258144-121258166 CCTTCTGAAATTGCCTCCTTGTG No data
Right 913688731 1:121258162-121258184 TTGTGGCCTGAAATCCTTTCTGG 0: 3
1: 0
2: 2
3: 20
4: 159
913688727_913688737 12 Left 913688727 1:121258144-121258166 CCTTCTGAAATTGCCTCCTTGTG No data
Right 913688737 1:121258179-121258201 TTCTGGGGTTTTCCTTAGGCTGG 0: 2
1: 1
2: 0
3: 10
4: 176
913688727_913688735 8 Left 913688727 1:121258144-121258166 CCTTCTGAAATTGCCTCCTTGTG No data
Right 913688735 1:121258175-121258197 TCCTTTCTGGGGTTTTCCTTAGG 0: 2
1: 1
2: 6
3: 37
4: 320
913688727_913688738 13 Left 913688727 1:121258144-121258166 CCTTCTGAAATTGCCTCCTTGTG No data
Right 913688738 1:121258180-121258202 TCTGGGGTTTTCCTTAGGCTGGG No data
913688727_913688732 -4 Left 913688727 1:121258144-121258166 CCTTCTGAAATTGCCTCCTTGTG No data
Right 913688732 1:121258163-121258185 TGTGGCCTGAAATCCTTTCTGGG 0: 2
1: 2
2: 1
3: 15
4: 168
913688727_913688733 -3 Left 913688727 1:121258144-121258166 CCTTCTGAAATTGCCTCCTTGTG No data
Right 913688733 1:121258164-121258186 GTGGCCTGAAATCCTTTCTGGGG 0: 2
1: 1
2: 2
3: 47
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913688727 Original CRISPR CACAAGGAGGCAATTTCAGA AGG (reversed) Intronic
No off target data available for this crispr