ID: 913690913

View in Genome Browser
Species Human (GRCh38)
Location 1:121279077-121279099
Sequence ATCAGCCCGCGCTCCCCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913690913_913690915 -7 Left 913690913 1:121279077-121279099 CCCAATGGGGAGCGCGGGCTGAT No data
Right 913690915 1:121279093-121279115 GGCTGATCTGCTCCACGTGCTGG No data
913690913_913690917 8 Left 913690913 1:121279077-121279099 CCCAATGGGGAGCGCGGGCTGAT No data
Right 913690917 1:121279108-121279130 CGTGCTGGCAACAGAGCCTGTGG No data
913690913_913690918 9 Left 913690913 1:121279077-121279099 CCCAATGGGGAGCGCGGGCTGAT No data
Right 913690918 1:121279109-121279131 GTGCTGGCAACAGAGCCTGTGGG 0: 3
1: 0
2: 1
3: 18
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913690913 Original CRISPR ATCAGCCCGCGCTCCCCATT GGG (reversed) Intronic
No off target data available for this crispr