ID: 913700054

View in Genome Browser
Species Human (GRCh38)
Location 1:121365652-121365674
Sequence GGTCCCTGGTTTGCTGCTAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913700054_913700057 -6 Left 913700054 1:121365652-121365674 CCGTTAGCAGCAAACCAGGGACC No data
Right 913700057 1:121365669-121365691 GGGACCCTGAACTAATGGCAAGG 0: 4
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913700054 Original CRISPR GGTCCCTGGTTTGCTGCTAA CGG (reversed) Intronic
No off target data available for this crispr