ID: 913703513

View in Genome Browser
Species Human (GRCh38)
Location 1:121396767-121396789
Sequence CGGCAAAAAGCCGTGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913703513_913703520 11 Left 913703513 1:121396767-121396789 CCCGCCGCCACGGCTTTTTGCCG No data
Right 913703520 1:121396801-121396823 GCTTTTTGCCCCCGCCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913703513 Original CRISPR CGGCAAAAAGCCGTGGCGGC GGG (reversed) Intergenic
No off target data available for this crispr