ID: 913706912

View in Genome Browser
Species Human (GRCh38)
Location 1:121434516-121434538
Sequence TGTGGCTGTGCTGGTACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 941
Summary {0: 20, 1: 95, 2: 164, 3: 271, 4: 391}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913706912_913706917 1 Left 913706912 1:121434516-121434538 CCTTAGGTACCAGCACAGCCACA 0: 20
1: 95
2: 164
3: 271
4: 391
Right 913706917 1:121434540-121434562 CAGAGGGACAGAGAACCAAGTGG No data
913706912_913706921 10 Left 913706912 1:121434516-121434538 CCTTAGGTACCAGCACAGCCACA 0: 20
1: 95
2: 164
3: 271
4: 391
Right 913706921 1:121434549-121434571 AGAGAACCAAGTGGGGTCTTGGG No data
913706912_913706920 9 Left 913706912 1:121434516-121434538 CCTTAGGTACCAGCACAGCCACA 0: 20
1: 95
2: 164
3: 271
4: 391
Right 913706920 1:121434548-121434570 CAGAGAACCAAGTGGGGTCTTGG No data
913706912_913706919 3 Left 913706912 1:121434516-121434538 CCTTAGGTACCAGCACAGCCACA 0: 20
1: 95
2: 164
3: 271
4: 391
Right 913706919 1:121434542-121434564 GAGGGACAGAGAACCAAGTGGGG No data
913706912_913706918 2 Left 913706912 1:121434516-121434538 CCTTAGGTACCAGCACAGCCACA 0: 20
1: 95
2: 164
3: 271
4: 391
Right 913706918 1:121434541-121434563 AGAGGGACAGAGAACCAAGTGGG No data
913706912_913706923 25 Left 913706912 1:121434516-121434538 CCTTAGGTACCAGCACAGCCACA 0: 20
1: 95
2: 164
3: 271
4: 391
Right 913706923 1:121434564-121434586 GTCTTGGGATCCCCAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913706912 Original CRISPR TGTGGCTGTGCTGGTACCTA AGG (reversed) Intergenic
900601802 1:3505904-3505926 TGTGACTGTGCTGGCATCCAGGG - Intronic
901450407 1:9333182-9333204 GATGGCTGTGCTGGTCCCTCTGG - Intronic
902143767 1:14379390-14379412 TGTGGCTGAGCAGGTACCTAAGG - Intergenic
903383321 1:22911409-22911431 TGTGTGTGTGCAGGTGCCTATGG - Intronic
904445861 1:30572533-30572555 TGTGGCTGCTCTGTTACCCATGG + Intergenic
906352980 1:45079614-45079636 TGTGGCTGAGCTGGTACCTAAGG + Intronic
906877924 1:49558274-49558296 TGTGGCCATTCTGGTACCTAAGG - Intronic
907834408 1:58095421-58095443 TGTGGCTCTTCTGTGACCTATGG - Intronic
908302299 1:62774040-62774062 TGTGGCCAAACTGGTACCTAAGG + Intergenic
908598990 1:65718802-65718824 TGTGGCAGTGTTGGTACCTAAGG + Intergenic
908624583 1:66026471-66026493 TGTCCCTGTTCTGCTACCTATGG + Intronic
908958912 1:69671007-69671029 TGTGGCAAAGCTGGTACCTAAGG + Intronic
909103832 1:71384243-71384265 TGTGGCTGATCTTGTACCTAAGG - Intergenic
909182303 1:72439780-72439802 TGTGACTATGCTGATATCTAAGG + Intergenic
909270476 1:73617483-73617505 TGTAGCAGTACTGGTACCTAAGG + Intergenic
909615694 1:77605988-77606010 TGTGGCTGAGCTGATACTTAAGG - Intronic
909781920 1:79558623-79558645 TGTTGCTGAGCTGGTACCTGAGG - Intergenic
910330663 1:86069121-86069143 TGTGGCCAAGCTGGTACATAGGG - Intronic
910546631 1:88425847-88425869 CGTGGCCAAGCTGGTACCTAAGG - Intergenic
910716390 1:90235942-90235964 TGTGGCCATGCTGGCATCTAAGG + Intergenic
911373655 1:97024624-97024646 AGTGGCTGAGCTAGTATCTAAGG - Intergenic
911536414 1:99105941-99105963 TGTGGCCAAGCTGGTTCCTAAGG - Intergenic
911939107 1:104019348-104019370 TGTGGCTGAGCTGGTACCTGAGG + Intergenic
911960942 1:104301685-104301707 TGTGGCCAAGCTGGTACCTAAGG - Intergenic
912018445 1:105072202-105072224 TGTGGCCAAGCTGGTACCTTAGG + Intergenic
912034996 1:105301405-105301427 TGTGGCAGTGTTGGTTCCTAAGG + Intergenic
912036638 1:105324745-105324767 TGTGGCCATGCTGGTACCTAAGG + Intergenic
912116973 1:106418975-106418997 CGTGGCTAAGCTGATACCTAAGG - Intergenic
912127331 1:106555312-106555334 TGTGGCTGAGCTGGTATCTAAGG - Intergenic
912242653 1:107927446-107927468 TGTGGCTGAGCTGGTACCTAAGG - Intronic
912598550 1:110903776-110903798 TGTGCCCATGCTGGTACTTAAGG - Intergenic
912601130 1:110934342-110934364 TGTTGCCATGCTGGTACCTAAGG - Intergenic
913416862 1:118618592-118618614 TGTGGTCAAGCTGGTACCTAAGG + Intergenic
913416908 1:118618951-118618973 TGTGGCTGAGCTGATATCTAAGG + Intergenic
913706912 1:121434516-121434538 TGTGGCTGTGCTGGTACCTAAGG - Intergenic
914984586 1:152445119-152445141 TGTGGCTGTGCTCATGCATATGG + Intergenic
915693645 1:157716340-157716362 TGTGGCCGAGCTGGTACCTAGGG + Intergenic
915856835 1:159397398-159397420 TGTGGCAGTGTTCTTACCTAAGG - Intergenic
916341829 1:163745215-163745237 TGTAGCTGAGCTGGTACCTAGGG + Intergenic
917003367 1:170385438-170385460 TGTGACTGTGCTGGTACTTAAGG + Intergenic
917061702 1:171048642-171048664 TGTAACTGTGCTGGGATCTAAGG + Intronic
917226401 1:172788476-172788498 TGTGACTGAGCTGGTACATAAGG + Intergenic
917246328 1:173004945-173004967 TGTGGCTAAACTGGTACCTAGGG + Intergenic
917986629 1:180326546-180326568 TGTGGCTGAGCTGGTACCTACGG + Intronic
918476250 1:184928201-184928223 TGTGGCTGAGCTGGTATCCAAGG + Intronic
918666223 1:187154484-187154506 TGTTGTTGTGTTGGTACCTAAGG + Intergenic
918756553 1:188345346-188345368 TGTGGTGGTGTTGGTAGCTAAGG + Intergenic
919003135 1:191860489-191860511 TGTGGCCCTTCTGGTATCTAAGG - Intergenic
919067778 1:192714703-192714725 TGTGGCTGAGATGGTAACTAAGG - Intergenic
919251826 1:195066179-195066201 TGTGTATGAGCTGGTAACTAAGG - Intergenic
919272062 1:195360595-195360617 TGTGGCCATGCTAGTACCTAAGG - Intergenic
919287599 1:195584849-195584871 TGTGGCTGTGTTGGTACCTAAGG - Intergenic
919325335 1:196099995-196100017 TGTGGCTGTGCTAGTACCTAAGG - Intergenic
920549588 1:206847201-206847223 TGTGTCCAAGCTGGTACCTAAGG - Intergenic
920594932 1:207259490-207259512 TGTGGTTGAGCTGGTATGTAAGG + Intergenic
920596764 1:207279777-207279799 TGTGGCTGAGCTGGTATCCCAGG + Intergenic
920740630 1:208578123-208578145 TGTGGCACAGCTGGTACCGAGGG + Intergenic
920744917 1:208617301-208617323 TGTGGCTGTGCTGGTATCTAAGG - Intergenic
921042603 1:211448271-211448293 TGTGGCCATGCTGGTTCCTAGGG - Intergenic
921238755 1:213154749-213154771 TGTGGCCTTGCTGGTATCTAAGG + Intronic
921634583 1:217477371-217477393 TGTGGCCAAGCTGGTACCTAAGG - Intronic
921741018 1:218685017-218685039 TGTGCCTGTGCTGGGACCTTAGG - Intergenic
921994001 1:221397265-221397287 TGTGGCTATGCTGGTACCTAAGG - Intergenic
924793271 1:247272579-247272601 TGTTGCCAAGCTGGTACCTAAGG + Intergenic
1062899590 10:1132791-1132813 TGTGGCTGTGGTGGTGGCTGAGG + Intergenic
1063520498 10:6736545-6736567 TGTGGCAATGGTGGTACCCAGGG - Intergenic
1063588338 10:7373064-7373086 TGTGGCAGTGCTGGGAGCTGAGG + Intronic
1066142974 10:32526410-32526432 TGTGGTTGAGCTGATACCTAGGG + Intronic
1068025201 10:51634167-51634189 TGAAGCTTTGCTAGTACCTAGGG - Intronic
1069814796 10:71186937-71186959 TGTGCCTGTGAGGGTAGCTATGG + Intergenic
1070059384 10:72967568-72967590 TGTAGCCGAGCTGGTACTTAAGG + Intergenic
1070915025 10:80148096-80148118 TGTGGTTGAGCTGGTATCTAAGG - Intergenic
1071018066 10:81021373-81021395 TGTGGCCGTACTGGTACCTCAGG - Intergenic
1071046697 10:81387567-81387589 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1071869743 10:89780976-89780998 TGTGGCCATGCTGGTACCTAAGG + Intergenic
1072400610 10:95095782-95095804 TATGGCTGCACTTGTACCTAAGG + Intergenic
1072447426 10:95511774-95511796 TGATGCTGGGCTGGTACCTCAGG - Intronic
1072843036 10:98796172-98796194 TGTGGCTGAGCTGATACCTAAGG - Intronic
1072862697 10:99022998-99023020 TGTGGTTGTGCTGGTACCTAAGG - Intronic
1072986912 10:100148991-100149013 TGTGGCTGTGCTGTTCCCTGGGG - Intergenic
1073823394 10:107291415-107291437 TGTGGCCGAGCTGGTACCTAAGG + Intergenic
1073905497 10:108274743-108274765 TGTGGGAGTTTTGGTACCTAAGG + Intergenic
1074070222 10:110060130-110060152 TGTAGCTTTGCTGTTAGCTAAGG + Intronic
1074226901 10:111493702-111493724 CTGTGCTGTGCTGGTACCTAAGG + Intergenic
1074408474 10:113201795-113201817 TGTGGCCAAGCTGTTACCTAAGG - Intergenic
1074638111 10:115344627-115344649 TGTGACTGTGTTAGTTCCTAAGG + Intronic
1074803522 10:117026065-117026087 TGTGGCTGAGCTGGTACCTAAGG - Intronic
1076094612 10:127721007-127721029 CCTTGCTGTGCAGGTACCTAAGG - Intergenic
1076540055 10:131208030-131208052 TGTGGTTGGGCTGGTCCCTAGGG - Intronic
1076693348 10:132234918-132234940 TGTGGCTGTGAAGGGACCTAGGG + Intronic
1076996057 11:298133-298155 TTTGGCTTTGGTGGTCCCTAGGG + Intergenic
1077740413 11:4839830-4839852 TGTGGTTGTGCTGGTACCTACGG - Intronic
1078490897 11:11767490-11767512 TCTGGATGGGCTGGTCCCTAAGG + Intergenic
1078540387 11:12208500-12208522 TGTGGTTGTACTTGTACCCATGG + Intronic
1079027497 11:16960687-16960709 TGTGGCTGAGCAGGGACCCAGGG - Intronic
1079069242 11:17328798-17328820 TGTGGCTGAGCTGGTACCTAGGG + Intronic
1079571793 11:21952583-21952605 TGTGGCTGAGCTGGTATCCAAGG - Intergenic
1079701740 11:23556531-23556553 TGTGGCTGAGCTGGTATCAAAGG + Intergenic
1079712856 11:23708299-23708321 TGTGGTGGTGTTGGTACCTAAGG - Intergenic
1080084204 11:28258872-28258894 TGTGGCTAAGCTTGTACCTAAGG + Intronic
1081319115 11:41668778-41668800 TGTGGCTGAGCTGATACTCAAGG - Intergenic
1082953806 11:58847345-58847367 TGTGGCTGTGCTGGCACCTAAGG - Intronic
1082970214 11:59012595-59012617 TGTGGCTGTGCTGGCACCTAAGG - Intronic
1083512776 11:63227137-63227159 TGCGGCTGAGCTGGTACCTAAGG + Intronic
1083528764 11:63397567-63397589 TGTGGCTGAGCTGGCACCCAAGG + Intronic
1083799540 11:65038597-65038619 TGTGGCTGAGCTGGCAACGATGG + Exonic
1084090565 11:66876865-66876887 TGTTGCTGTGCTTGTCCCGAAGG - Intronic
1085753071 11:79178753-79178775 TGTGACTGTGCTGGACCCTGTGG - Intronic
1086036531 11:82422204-82422226 TGTGGCTGTGAGTGTGCCTATGG + Intergenic
1086524616 11:87711001-87711023 TGTGCCCAGGCTGGTACCTAAGG - Intergenic
1087178639 11:95120159-95120181 TGTGGCTGAGCTGGTACCTGAGG + Intronic
1087201324 11:95347232-95347254 TGTGACAATGCTGGTACCTAAGG - Intergenic
1087370709 11:97280052-97280074 TGTGGCCGAGCTGATACCTAGGG - Intergenic
1087402390 11:97684133-97684155 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1087598390 11:100283083-100283105 TGTGGCTGAGCTGGTACCTAAGG + Intronic
1088045762 11:105449060-105449082 TGGCGCAGGGCTGGTACCTAAGG - Intergenic
1088154849 11:106790487-106790509 TGGGGCTGAGCTGGTACCTAAGG + Intronic
1088210757 11:107453675-107453697 TGTGGCTGAGCTGGTACCTAAGG - Intronic
1088362017 11:109001210-109001232 AGTGGCTGAGCTGGTACCTAAGG + Intergenic
1088362076 11:109001569-109001591 TGTGGCTCAGCTGGTATCCAAGG + Intergenic
1088928702 11:114327579-114327601 TATGGATGTCCTTGTACCTAAGG - Intergenic
1088938214 11:114425936-114425958 TGTGGTTGAGCTGGTATCTGAGG + Intronic
1088985195 11:114899621-114899643 TGTGGCTGAGCTGGTACCCGAGG - Intergenic
1089937081 11:122375616-122375638 TGTGGCCAAGCTGGTACATAAGG - Intergenic
1090318284 11:125817216-125817238 TGTGGCTGAGTTGGTACCAAAGG + Intergenic
1090676900 11:129007224-129007246 TGTGGCCAAGCTGGTACCTAAGG + Intronic
1091664941 12:2412115-2412137 TGTGGCTGTGGAGGTCCCTCAGG + Intronic
1092670870 12:10859143-10859165 TGTGGCTGACCTGGTACCTAAGG - Intronic
1093588609 12:20872426-20872448 TGTAGCTGAGCTGCTACCTAAGG + Intronic
1093903305 12:24661096-24661118 TGTGACCGAGCTGGCACCTAAGG + Intergenic
1093991102 12:25591070-25591092 TGTGGCCAAGCTAGTACCTAAGG - Intronic
1094380755 12:29840626-29840648 TGTGGCTGAGCTAGTACCTAAGG + Intergenic
1094489840 12:30952915-30952937 TGTGGGTGTGCAGGTGCCCAGGG + Intronic
1094658194 12:32441143-32441165 TGTGGCAGTGTTGGTACCTAAGG + Intronic
1094741627 12:33296316-33296338 TGTGGCTCACCTGGTATCTAAGG - Intergenic
1094816055 12:34186079-34186101 TGTGGCTGAGCTGGTATATGAGG + Intergenic
1095227529 12:39695250-39695272 CATGACTGTGCTGGTACCTAAGG - Intronic
1096343955 12:50828762-50828784 TGTGGCCGAGCTGGTACCTCGGG + Intergenic
1096607470 12:52777008-52777030 TGTGGCTTTGCAGGTGGCTATGG - Exonic
1097146998 12:56948613-56948635 TGTGGCCATGCTGGCACCTAAGG + Intergenic
1097150895 12:56979116-56979138 TGTGGTCTTGCTGGCACCTAAGG + Intergenic
1097569045 12:61308263-61308285 TGTGGCTGAGCTGGTGTCCAAGG + Intergenic
1097591656 12:61582339-61582361 TCTGGCTGTGCTGTTATTTATGG + Intergenic
1097791343 12:63818454-63818476 TGTGGCTGTGCTGTTACCTAAGG - Intergenic
1097899260 12:64857090-64857112 TGTGGCTGAGCTGGTATCTAGGG + Intronic
1098207913 12:68132591-68132613 TGTGGCTGAGCTGATACCTAAGG + Intergenic
1099031531 12:77531153-77531175 AGTGAATGTGGTGGTACCTAGGG + Intergenic
1099433783 12:82619719-82619741 TGTGGCTGAGCTGGCACCTAAGG - Intergenic
1099495313 12:83339673-83339695 TGTGCCTGAGCTGGTACCTAAGG - Intergenic
1099562235 12:84192787-84192809 TGTGGTTGAGATGGTACCTAAGG + Intergenic
1099564914 12:84230647-84230669 TGTGGCCATGCCAGTACCTAAGG + Intergenic
1099610084 12:84857224-84857246 TGTGGCGGAGCTGGTACCTAAGG + Intergenic
1099764158 12:86960824-86960846 TGCGACTGAGTTGGTACCTAAGG + Intergenic
1100995969 12:100301765-100301787 TATGGCCAAGCTGGTACCTAAGG + Intronic
1101014447 12:100485101-100485123 TGTGACTGGGCAGGTACATAGGG - Intronic
1101026202 12:100609158-100609180 TGTGGCTGAGTTGGCCCCTAAGG + Intronic
1102317948 12:111905131-111905153 TGTGGCCGAGCTGGTACCTAAGG - Intergenic
1103461387 12:121107729-121107751 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1104103147 12:125634423-125634445 TGTGGTCAAGCTGGTACCTAAGG + Intronic
1106349986 13:28921048-28921070 TGCAGCTGAGCTGGTACCTGAGG + Intronic
1106645522 13:31629796-31629818 CATGGCAGTGTTGGTACCTAAGG + Intergenic
1106895990 13:34302863-34302885 TGTGGTAGAGCTGGTTCCTAAGG - Intergenic
1107725245 13:43292733-43292755 TATGGCTGTGTTGGTGGCTATGG - Intronic
1108099307 13:46936845-46936867 TGTGGCTGAGCTGGAACCCAAGG - Intergenic
1108922545 13:55693622-55693644 TGTGTCCATGCTGGTACCTAAGG - Intergenic
1108973246 13:56402989-56403011 TGTGGCTGAGCTGACCCCTAAGG - Intergenic
1108989809 13:56640668-56640690 TGTGGCTGAGCTGGTATCCAAGG - Intergenic
1109022729 13:57119053-57119075 TGTGGCTGAGCTGGTACCTGAGG + Intergenic
1109336683 13:61003472-61003494 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1109522743 13:63534073-63534095 TGTAGCTGTGCTGGAACCTAAGG + Intergenic
1109826447 13:67728025-67728047 TGTGATTGTGTTGGTACCTAAGG + Intergenic
1109886995 13:68556097-68556119 TGTGGCAGTGGGGCTACCTAGGG - Intergenic
1110376732 13:74802718-74802740 TGTGGCAGAGCTGCTATCTATGG - Intergenic
1110501304 13:76231490-76231512 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1110721370 13:78766105-78766127 TGTGGCTGTGCAAATACCAAGGG + Intergenic
1110915174 13:81012173-81012195 TGTGGTCAAGCTGGTACCTAGGG + Intergenic
1111365216 13:87234498-87234520 TGTGGCTGAGCTGGAACCTAGGG + Intergenic
1111542656 13:89689254-89689276 TGTGGCTGAGATGGTATCCAAGG - Intergenic
1113891365 13:113737277-113737299 TGTGGCTGACGTGGGACCTATGG - Exonic
1114400053 14:22401906-22401928 TGTGTCTCTCCTGGTAACTATGG + Intergenic
1114761591 14:25322178-25322200 TGTGACTGAGCTAGTACCTAAGG + Intergenic
1114783735 14:25570150-25570172 TGTGGTTGAGCTGGTACCTAGGG + Intergenic
1114985132 14:28217395-28217417 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1115282383 14:31678287-31678309 TGTGGCTGAGCTGGCACCTAAGG + Intronic
1115821000 14:37212224-37212246 GGTGGCAATGCTGGTATCTAAGG - Intronic
1115918349 14:38342816-38342838 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1116079402 14:40154396-40154418 TGTGGCTGAGGTGGTACCCAAGG - Intergenic
1116351721 14:43871627-43871649 TGTGGCCGTGCTGTTACCTAAGG + Intergenic
1116407065 14:44579347-44579369 TGTGGCTTTGCTGGTACCTAAGG - Intergenic
1116422139 14:44745109-44745131 CATGGCTGAGCTGGTACTTAAGG - Intergenic
1116434052 14:44877235-44877257 TATGGCTGCGCCTGTACCTAAGG - Intergenic
1116458447 14:45144835-45144857 TGTGGCTGAGCTGGTACCTGAGG + Intronic
1116725152 14:48553875-48553897 TGTGGTAGTGTTGGTACGTAAGG + Intergenic
1116765952 14:49070710-49070732 TGTGGCCAAGCTCGTACCTAAGG - Intergenic
1116889074 14:50249805-50249827 TGTGGCTGAGCTGGTACCTAAGG - Intronic
1116930740 14:50688341-50688363 TGTGGCCGTGCTGGTATTTAAGG + Intergenic
1117110371 14:52447055-52447077 TCTGGCAGAGCTGGTACCTATGG - Intronic
1117264923 14:54076799-54076821 TGTGGCCATGCTGGTACTTAAGG + Intergenic
1117384258 14:55195035-55195057 TGTGGCTGAACTGGTACCTAAGG + Intergenic
1117483121 14:56168668-56168690 TGTGGCCGTGCTGGTACGTAAGG + Intronic
1117634693 14:57729587-57729609 TGTAGCTGAGCTGGTATCCAAGG + Intronic
1118084407 14:62398687-62398709 TGTGGCTATGCTAGTACCTAAGG + Intergenic
1119736259 14:76984687-76984709 TGAGGCTGTGCTGGAAGCTCTGG - Intergenic
1119814961 14:77557805-77557827 TGTGGCTCTGTTGGTTCTTATGG + Intronic
1119856145 14:77902568-77902590 TGTTGCTGTGCTGGGAGCTGAGG + Intronic
1120135678 14:80865926-80865948 TGTGGCTTTGCTGGGTCCTTTGG - Intronic
1120808146 14:88775261-88775283 TATGGCCATGCTGGTACCTAAGG - Intronic
1121237255 14:92401237-92401259 TGCTGCTGTGCTGGTAGATAGGG + Intronic
1121375948 14:93410957-93410979 TGTGGCTGAGCTGGTACATATGG - Intronic
1121759765 14:96435098-96435120 TTTGGCCATGCTGGCACCTAAGG + Intronic
1121917249 14:97846606-97846628 TGTGGCTGTGCTGGTGTTGATGG + Intergenic
1123508638 15:20972352-20972374 TTTGACTGTGCTGGTACTTAAGG + Intergenic
1123565859 15:21546101-21546123 TTTGACTGTGCTGGTACTTAAGG + Intergenic
1123602119 15:21983388-21983410 TTTGACTGTGCTGGTACTTAAGG + Intergenic
1123697614 15:22890544-22890566 TGTGGCTGTGTTGGTGCCCCAGG - Intronic
1123713092 15:23005188-23005210 TGTGGCTGTGCCTGTCCCCAGGG + Intronic
1125567154 15:40685448-40685470 TGTGACTGAGCTGGTACCCAAGG + Intergenic
1126503900 15:49380376-49380398 CATGGCTTTGCTGGTACCTAAGG + Intronic
1127012451 15:54644851-54644873 TGTGGCTGTGCTGGTACCTAAGG - Intergenic
1127173492 15:56328430-56328452 TGTGGCTGAGCTGGTACATAAGG - Intronic
1127178015 15:56382356-56382378 TGTGGCTGTGCTAGTTCTTAAGG + Intronic
1128317516 15:66670401-66670423 AGGTGCTGTGCTGGAACCTAAGG + Intronic
1129501008 15:76037892-76037914 TGTGGCTGAGCTGGTGTCCAAGG - Intronic
1130372691 15:83299495-83299517 TGTGGCTTTGCTGGGTCCTCTGG + Intergenic
1131932750 15:97463207-97463229 TTTGTCTGTGATAGTACCTATGG + Intergenic
1131953064 15:97702609-97702631 TGTGGATGTGGTGGGATCTAGGG + Intergenic
1132230633 15:100181307-100181329 TGTGGCCAAGCTGGTACCTAAGG + Intronic
1132439112 15:101841323-101841345 TGTGGCTGAGCTGATAGCTGAGG + Intergenic
1202974228 15_KI270727v1_random:273194-273216 TTTGACTGTGCTGGTACTTAAGG + Intergenic
1132897277 16:2235017-2235039 TGGGGCCGTGCTGGGACCCAGGG + Intronic
1134689401 16:16181412-16181434 GGTGGCTGTGGTGGTAGATAAGG + Intronic
1136254521 16:29029342-29029364 TGTGGCGGGGCTGGGCCCTAGGG - Intergenic
1136389169 16:29951474-29951496 TGTGTCCGAGCTGGTATCTAAGG + Intronic
1136550385 16:30979650-30979672 TGTGGCTGAGCAGGGGCCTAGGG - Exonic
1136676582 16:31913905-31913927 TGTGGCCAAGCTGGTACCTCAGG + Intronic
1137227139 16:46524204-46524226 CATGGCCGTGCTGGTGCCTAAGG + Intergenic
1138581925 16:57947126-57947148 TGTTGGTGTGCTGGTGCATATGG + Intronic
1138844935 16:60554175-60554197 TGTGGATGAGCTGGTACCTAAGG + Intergenic
1138916558 16:61471700-61471722 TGTGGCTGTGCTGGTACCTAAGG - Intergenic
1139103812 16:63801945-63801967 TGTGGCCTTGCCGGTACCTAAGG + Intergenic
1140158129 16:72455284-72455306 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1140646629 16:77038354-77038376 TGTGGTTGTGCTCGTATCTAAGG + Intergenic
1141482958 16:84318879-84318901 TGTGGCTGTCCTTGTGCCTGTGG + Intronic
1142202332 16:88767281-88767303 TGTGGCTGTGCTGAGACCCCTGG + Intronic
1143479203 17:7218979-7219001 GGTGGCGGTGCTGGTGCCTTGGG - Exonic
1144375106 17:14631802-14631824 TGTTGCTGTGCTTGCAACTACGG + Intergenic
1145910524 17:28539513-28539535 TGTGGCTGCTCTGGGACCTGGGG - Intronic
1146749926 17:35369140-35369162 TGTGGCTAAGCTGGTACCTACGG - Intronic
1148754133 17:49963694-49963716 TGTGGCTGTGTGGTTGCCTATGG + Intergenic
1149108519 17:52997736-52997758 TGTGGCTGTGCTGGCACCTAAGG - Intergenic
1149157347 17:53647748-53647770 TGTGGCTGTGCTGGTACCTAAGG + Intergenic
1149239791 17:54635699-54635721 TATAGCTGAGCTGGTACCTAAGG - Intergenic
1152031580 17:77846473-77846495 TGTGGCTGTGCTGGGAAAGAAGG - Intergenic
1152582028 17:81170298-81170320 TGTGTCTGTGTTGGTATGTAGGG + Intergenic
1153074664 18:1148666-1148688 TGTGGCAGAGCTGGCACCTAAGG - Intergenic
1153075313 18:1155984-1156006 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1153389198 18:4534888-4534910 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1153715048 18:7839182-7839204 TGTGCCCGAGGTGGTACCTAGGG + Intronic
1153803101 18:8688946-8688968 TGGGAATGTGCTGGTTCCTACGG + Intergenic
1154386587 18:13898023-13898045 AGTGGCTATGCTGGTACCTAAGG - Intronic
1155282136 18:24250754-24250776 TGTGGCCAAGCTGGTACTTAAGG - Intronic
1155533797 18:26794994-26795016 TGTGGCCCAGCTGGTGCCTAAGG - Intergenic
1155597286 18:27502639-27502661 TGTGGCCAAGCTGGTAACTAAGG - Intergenic
1155782067 18:29849500-29849522 TGTGGCTATGCTGGTACCTAAGG + Intergenic
1156094256 18:33510420-33510442 TGTGGCTGAGCAGGGACCTAAGG - Intergenic
1156912376 18:42426005-42426027 TGTGGCCAAGCTGGCACCTAAGG + Intergenic
1157817147 18:50737882-50737904 TGTGGCTGTGCAGTTGCCTGAGG + Intergenic
1157817333 18:50739212-50739234 TGTGGCTGTGCAGTTGCCTGAGG + Intergenic
1159080635 18:63731578-63731600 TGTGGCCAAGCTGGTACCTAAGG - Intergenic
1159092023 18:63860499-63860521 TGTGGCCAAGTTGGTACCTAAGG + Intergenic
1159260222 18:66004384-66004406 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1159292527 18:66440504-66440526 GGTGCCTGTGCTGGTGCCTGGGG + Intergenic
1159339676 18:67118996-67119018 TGTGGCCAAGCTGGTACCCACGG + Intergenic
1159394538 18:67838792-67838814 TGTGGTTGAGCTGGTACCTAAGG + Intergenic
1159896495 18:74001627-74001649 TATGGCTGAGCTGGTACCTAAGG + Intergenic
1162666763 19:12220176-12220198 TGTGGCCATGCTGGTGCCTAAGG + Intergenic
1164491079 19:28714819-28714841 TGTGGCTGTGCTAGTACCTAAGG - Intergenic
1165645353 19:37431343-37431365 TGTGGCTGAGCTGGTATCCAAGG - Intronic
1165964384 19:39563216-39563238 TGTGGCCATGCAGGTACCTAAGG + Intergenic
1165984059 19:39752033-39752055 TGTGGTCATGCTGGTACCTAAGG - Intergenic
1166408328 19:42539642-42539664 TGTGGCTGAGCTGGTACCTGAGG + Intronic
1167003085 19:46757235-46757257 TGGGGCTGTGCTGGGCCCTGCGG - Exonic
1167466755 19:49654233-49654255 TGTGGCTGTTCTGGGGCCAAGGG + Intronic
1168122486 19:54259657-54259679 TGTTGTTGAGCTGGTACCTAAGG + Intronic
1168579682 19:57544461-57544483 TGTGGCTGTACTTGTACCTAAGG - Exonic
925249670 2:2421681-2421703 TGTGGCTGAGTTAGTACCTCAGG + Intergenic
926478353 2:13356905-13356927 TGTGGCAGAGCTGGTACCTAAGG - Intergenic
926600912 2:14844550-14844572 TGTGGCAGAGCTGGTACCTAAGG - Intergenic
926834148 2:16999058-16999080 TGTGACTGAGCTGGTACTTAAGG + Intergenic
927309777 2:21617402-21617424 TGTGGCTGTGCTGGTGCCTAAGG + Intergenic
927570267 2:24153189-24153211 TATGACTGAGCTGGGACCTAAGG + Intronic
928802916 2:35115829-35115851 TGTGGCCAAGCTGGTACCTAAGG - Intergenic
929215133 2:39404227-39404249 TGTGGCTGAGCTGGTACCTAAGG - Intronic
929388652 2:41442355-41442377 TGTGGTTGTGCTGGTATCTAAGG + Intergenic
930336429 2:50053307-50053329 TCTGGCTGTGCTAGTAGCCAGGG + Exonic
930492549 2:52093541-52093563 TGTGACTGAGCTGGTATCCAAGG + Intergenic
930727409 2:54695376-54695398 TGTGGCCGAGCTGCTACCTAAGG - Intergenic
930944886 2:57061557-57061579 TGTGGCTGAGCTGGAGCTTAGGG + Intergenic
930947470 2:57092604-57092626 TGTGGCAGAGCTAGTACTTAAGG + Intergenic
930970205 2:57385951-57385973 TGTGGCTGACCTCATACCTAAGG - Intergenic
931012169 2:57929554-57929576 TGTGGCTGAGCTGGTACCTAAGG + Intronic
931254033 2:60554854-60554876 TGTTCCTGTGCTGTTACCCAGGG + Intergenic
931637268 2:64351941-64351963 TGTGGCAGTGTTGATATCTAAGG - Intergenic
931989804 2:67778937-67778959 TGTGACTGTGCTGGTACTTAAGG - Intergenic
932858786 2:75266888-75266910 TGCGGCTGAGCCTGTACCTAAGG + Intergenic
933576851 2:84079427-84079449 TATGGCTAAGCTGATACCTAAGG + Intergenic
935078619 2:99770480-99770502 TGTGGCCAAGCTGGTACCTAAGG + Intronic
935576571 2:104717406-104717428 TGTGACTGAGTTGGTACCTAAGG + Intergenic
935675577 2:105592618-105592640 TGTGGGTGTGCTGGGGCCCAGGG - Intergenic
935750962 2:106233357-106233379 TATGGCCAAGCTGGTACCTAGGG - Intergenic
936175876 2:110219350-110219372 TGTGGGTTTGCTGGTACTTGTGG - Intergenic
936567672 2:113593538-113593560 TGAGGCTGTCCTGGGAACTAGGG + Intergenic
936831548 2:116653948-116653970 TTTGGCTGAGCTAGTACCTAAGG - Intergenic
937512507 2:122611907-122611929 TGTGGCTGAGCTTGTACCTAAGG - Intergenic
937552180 2:123107798-123107820 TGTAGCTACGCTGGTACCAAAGG + Intergenic
937617601 2:123944426-123944448 TGTGGCTATGCCAGTACCTAAGG - Intergenic
938177934 2:129153209-129153231 TGTGGCTGAGCTGGTACCTAGGG + Intergenic
938216994 2:129526526-129526548 TGTGGCAGAGCTAGTACTTACGG - Intergenic
938577534 2:132618815-132618837 TGTGGTTGTGGAGGTCCCTACGG + Intronic
938619269 2:133032118-133032140 TGTGGCTGTGCTGGTGCCTAAGG - Intronic
939144525 2:138396506-138396528 TGTGGCTGACCTGGTACCTAAGG - Intergenic
939443200 2:142275926-142275948 TGTGGTTGTGCTGGTACCTAAGG + Intergenic
939542706 2:143513132-143513154 TTTGGCTTTGCTGGTAACTGGGG + Intronic
939800425 2:146700580-146700602 TGTGGCAGTGTTGGTACCTAAGG - Intergenic
939930763 2:148230542-148230564 TGTGGCTCAGCTGGTAACTAAGG + Intronic
940315161 2:152320488-152320510 TGTGGCCAAGCTGGTACCTAAGG + Intergenic
940443944 2:153754197-153754219 TGTGGCCAGGCTAGTACCTAAGG + Intergenic
940560347 2:155287805-155287827 TGTGGCTGAGCTGGTACGTATGG - Intergenic
941672575 2:168310609-168310631 TGTGGCTGTGCTGGTACCCAAGG + Intergenic
942352324 2:175065576-175065598 TATGGCTGAGCTGGTATCTAAGG - Intergenic
942391829 2:175502912-175502934 TGTGTCTGAGCTGGTACCCAAGG + Intergenic
942734711 2:179096798-179096820 TGTGGCTGAGCAGGTATGTAAGG + Intergenic
942750065 2:179277108-179277130 TGTGGCCGAGCTGGTACCTAAGG - Intergenic
942769093 2:179495011-179495033 TGTGGCCGTGCTGATATCTAAGG - Intronic
942814295 2:180033867-180033889 TGTGGCTGACCTGGTACTTAGGG + Intergenic
943118956 2:183710233-183710255 CATGGCTGTGCTGGTACCTAAGG + Intergenic
943170026 2:184386274-184386296 TGTGGCTGAGTTGTTACCTAAGG - Intergenic
943208203 2:184927975-184927997 TGTGGCAGAGCTTGTAGCTAAGG + Intronic
943226777 2:185188023-185188045 TATGGCTGTACTGGTACCTAAGG + Intergenic
943484711 2:188465004-188465026 TGTGGCTGAGCTGGTACCTAAGG + Intronic
943933594 2:193886110-193886132 CATGGCTGAGCTGGTACCTAGGG - Intergenic
944751993 2:202718279-202718301 TGTGGCCAAGCTGGTACCTAAGG + Intronic
944963367 2:204901589-204901611 TGTGGCAGAGCTTGTATCTAAGG + Intronic
944990516 2:205230141-205230163 TACGGCTGAGCTGGTACCTAAGG + Intronic
945210237 2:207375231-207375253 TGTGGCTGAGCTGATACCTAAGG - Intergenic
945739757 2:213645349-213645371 TGTGGCTGTGCTGGTACCTGAGG + Intronic
946351798 2:219160315-219160337 TATGGTTGTGGTGGGACCTAGGG - Intronic
946984706 2:225258389-225258411 TGTGGCTGTGCTGGTATCTCAGG - Intergenic
947199127 2:227599037-227599059 GGTGGCTGTGGTGGTAGCTGTGG + Intergenic
947439742 2:230108992-230109014 TGTGGCCAAGCTGGTACCTAAGG + Intergenic
947687134 2:232097745-232097767 TGAGGCCGAGCTGGTACCTAAGG + Intronic
948076200 2:235167086-235167108 TGATGCTGTGCTGGTTTCTAGGG + Intergenic
948881628 2:240860743-240860765 TGTGGCTGTGATGGCACAGAAGG - Intergenic
1168742062 20:200388-200410 TGTGGCCAAGCTGGTACCTAAGG + Intergenic
1168807674 20:682110-682132 AGTGGCTGTGCTGACAACTATGG + Intergenic
1169587030 20:7096731-7096753 TGTTGCCATCCTGGTACCTAAGG - Intergenic
1169617967 20:7471331-7471353 TTTGGCTGAGTTGGTACATAAGG + Intergenic
1170086949 20:12544452-12544474 TGTGGCTGTGCTGGTACCTAAGG + Intergenic
1171458564 20:25285701-25285723 TGTGTCTGTGCATGTACCTGTGG + Intronic
1171779421 20:29405729-29405751 TCTGGCCTTGCTGGTACCTAAGG - Intergenic
1172203584 20:33145854-33145876 TGTAGCCAGGCTGGTACCTAAGG + Intergenic
1173204217 20:40979935-40979957 TGTGGCTGAGCTAGTATCTAAGG + Intergenic
1173753501 20:45495137-45495159 TGTGCCAGTACTGGTACCCATGG - Intergenic
1174605097 20:51755620-51755642 TGTGGCTTTGCTGGGCCCTAGGG - Intronic
1175911163 20:62406204-62406226 TGTGGCTGTGCAGGGGCCTCTGG + Intronic
1177569642 21:22870863-22870885 TGTGGTTAGGCTGGTACCTAAGG + Intergenic
1177577954 21:22982903-22982925 TGTGGCCATGCTGGGACCTAAGG - Intergenic
1177740620 21:25148675-25148697 CTTGGCTGAGCTGGTACCTAAGG + Intergenic
1177969992 21:27777733-27777755 TGTGGCCAAGCTGGTATCTAAGG - Intergenic
1178216606 21:30605945-30605967 TGTGGCAGTGTTGGTACCTAAGG - Intergenic
1178514837 21:33237563-33237585 TCTGGATGTGGTGGTATCTAGGG + Intronic
1179974092 21:44853936-44853958 TGTGACTGTGCTGTGACCTGAGG - Intronic
1181716874 22:24737594-24737616 TGTGGCTGAGATGGCACCTAAGG - Intronic
1182347399 22:29675996-29676018 TGTGGCTTTGTTAGTACCTCTGG + Intronic
1182718555 22:32378829-32378851 TGAGGCTGTGCTGCCACCTAGGG + Intronic
1182842548 22:33403450-33403472 TGTGGTTGTGCTGGGAAATAAGG - Intronic
1184493136 22:44821838-44821860 TGTGGCTGCGCTGCTCCCTGGGG + Intronic
1185388815 22:50548243-50548265 TGTGGAAGTGCTGGGACCCACGG - Exonic
949155886 3:827001-827023 CGTGGCCATGCTGGTACCTAAGG - Intergenic
950708927 3:14801639-14801661 TGAGGCTTTGCTGGCACCTATGG - Intergenic
951032233 3:17895404-17895426 TGTGGCTGTGCTGTTACCTAAGG + Intronic
951172146 3:19554737-19554759 TGTGGCCATGCTGATACCTAAGG + Intergenic
951204372 3:19910106-19910128 TGTGGCCATGCTGGTACCCAAGG - Intronic
951279540 3:20731545-20731567 TGTGGCCAAGATGGTACCTAAGG + Intergenic
951435452 3:22657371-22657393 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
951819361 3:26791121-26791143 TGTGGTTGTGGGGATACCTAAGG + Intergenic
951904304 3:27688803-27688825 TGTGGCAATGTTGGTACCTATGG - Intergenic
951929747 3:27952016-27952038 TGTGGCTGTGCTCGTATCTGTGG + Intergenic
952132805 3:30384403-30384425 TGTGGTCGAGCTGGTACCTAAGG + Intergenic
952132859 3:30384762-30384784 TGTGGCTGAGCTGGTATCCGAGG + Intergenic
952139825 3:30466112-30466134 TGTGGCAGTCTTGGTACCTAAGG + Intergenic
952259379 3:31724966-31724988 TGTGGCTGTGGGTTTACCTATGG - Intronic
952566838 3:34669205-34669227 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
952639789 3:35579734-35579756 TGTGGCTAAGCTGGTATCTAAGG - Intergenic
952688421 3:36175792-36175814 TGTGGCTGAGCTGGTATCCAAGG + Intergenic
952877029 3:37954725-37954747 TGTGGCTGTGATGGTGGCAATGG - Intronic
953309522 3:41863441-41863463 TTTGGCCATGCTGGTACCTAAGG + Intronic
953309590 3:41863797-41863819 TGTGGCTGGGCTGGTATCCTAGG + Intronic
953362458 3:42309832-42309854 TGTGGCTAAGCTGGTATCCAAGG + Intergenic
953722584 3:45369254-45369276 TGTGGCCATGCTGGTACCTAAGG - Intergenic
955066900 3:55541347-55541369 TGTGGCTTTTCTGGGACCTAAGG - Intronic
956222980 3:66923696-66923718 TGTGGCCAAGCTGGTACCTAGGG - Intergenic
956717580 3:72091862-72091884 TGTGGTTGGGCTGGAACTTAGGG + Intergenic
957085720 3:75674923-75674945 TCTGGCCTTGCTGGTACCTAAGG + Intergenic
958078365 3:88712866-88712888 GGTGACTGTGCTGGTACCTAAGG - Intergenic
958617617 3:96515451-96515473 TGTGGCTGTGCTGGTACTTAAGG - Intergenic
958631195 3:96685805-96685827 TGTGGCTGTGCTGGTACCTAAGG + Intergenic
958847201 3:99278939-99278961 CATGGCGGTGTTGGTACCTAAGG - Intergenic
959041927 3:101431938-101431960 TGTGGCCATGCTGGTACCAAAGG - Intronic
959118552 3:102206433-102206455 TGTGACTGAGCTGGTATCCAAGG + Intronic
959725023 3:109533234-109533256 TATGTCTGAGCTGGTACCTAAGG + Intergenic
959761995 3:109976830-109976852 TGTGGCCATGCTGGTACCTAAGG + Intergenic
960541189 3:118864373-118864395 TGTATCTGTGCCAGTACCTAAGG + Intergenic
960681271 3:120249842-120249864 TGTATCTGTGGTGGTACCTAAGG - Intronic
960784992 3:121362729-121362751 TGTGGCTGTGCTGATATCTAAGG + Intronic
960870017 3:122239069-122239091 TGTGGCTGAACTGGTACCTAAGG - Intronic
961115138 3:124322801-124322823 TGTGGCTGTCGTTGTACCTAGGG + Intronic
962151944 3:132902727-132902749 GGTGGCCATGCTGGTACCCAAGG - Intergenic
962483328 3:135816625-135816647 TGTGGCTGAGCTGGTACCAGAGG - Intergenic
963107689 3:141660518-141660540 TGGGGCTGTGCGGGTGCATAGGG - Intergenic
963448054 3:145440149-145440171 TGTGGCACTGTTGGTACCTAAGG - Intergenic
963515308 3:146301329-146301351 TGTGGCTGTGCTGGCACCTAAGG - Intergenic
963591796 3:147269895-147269917 TGTTGCCATGCTGGTACCTAAGG - Intergenic
964021769 3:152021826-152021848 TGTGGCTGAACTGGTACCTAAGG - Intergenic
964059592 3:152505350-152505372 TGTGGCAGTGTTGGTACCTAAGG + Intergenic
964178007 3:153848937-153848959 TGATGCTGTGCTGGTCACTATGG + Intergenic
964615380 3:158658444-158658466 TGTGGCTGGGCTGGTCGCTCAGG - Intronic
964758905 3:160115057-160115079 TGTGGCTGTGCTGGTACCTAAGG - Intergenic
964804092 3:160587832-160587854 TGTGGCTCAACTGGTATCTAAGG - Intergenic
964936452 3:162094744-162094766 TGAGGCTTTGCTGGTACCTAAGG + Intergenic
965016748 3:163168018-163168040 TGTGGCTGTGATGGTACCTAAGG + Intergenic
965209596 3:165768027-165768049 CGTGGCTGAGCTGGTACCTAAGG + Intergenic
965260493 3:166477987-166478009 TGTGGCTAAGCTGGTACTTAAGG - Intergenic
965273709 3:166653365-166653387 TGTGGCTGTGCTGGTACTCGTGG - Intergenic
965349958 3:167599572-167599594 TATGGTTGATCTGGTACCTAAGG + Intronic
965350918 3:167610186-167610208 TGTGGCCATGCTGGCACCTAAGG - Intronic
965867023 3:173216804-173216826 TCTGTCAGAGCTGGTACCTACGG + Intergenic
966348557 3:179004996-179005018 TTTGGCTGAGCTGGTACCTAAGG - Intergenic
966452058 3:180074067-180074089 TGTGGCCGAGGTGGTACCTAAGG - Intergenic
966491032 3:180529118-180529140 TGTGGCTGTGCTGGTACCTCAGG - Intergenic
966551825 3:181213862-181213884 TGTGGGTGTGCTGGAGCCTGTGG + Intergenic
967632957 3:191768408-191768430 TGTGGCCCTGCTGGCACCTAAGG - Intergenic
968491545 4:893020-893042 TGTGGCTGTGCTGCTTCGTCCGG - Intronic
968883411 4:3313626-3313648 TGTGGCAGAGCTGGTTCCTCTGG + Intronic
968884935 4:3323310-3323332 TGTGTCTGTGATTGTACCTTTGG - Intronic
970432488 4:16001558-16001580 TGTGGGTGTGATGCCACCTAGGG + Intronic
970441869 4:16086891-16086913 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
970667474 4:18354069-18354091 TGTTGCTGTGCTGGTACCTAAGG + Intergenic
971076007 4:23150917-23150939 TGTGACTGAGCTGGTAGATAGGG - Intergenic
971105272 4:23517592-23517614 TGTGGCTGATCTGGTGCCCATGG + Intergenic
971701601 4:29984586-29984608 TGTGGCTTAGCTGGTATCTAGGG - Intergenic
971914527 4:32850843-32850865 TGTGGCTGAGCTGATACCTAAGG + Intergenic
972104138 4:35461620-35461642 TGTAGCCATGCTGGTACCTAAGG + Intergenic
972271075 4:37511201-37511223 TGTGACAGAGATGGTACCTAAGG + Intronic
972468769 4:39384071-39384093 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
972851609 4:43057405-43057427 CATGGTAGTGCTGGTACCTAAGG - Intergenic
972856530 4:43114103-43114125 TGTGACCATGCTGATACCTAAGG - Intergenic
972885136 4:43476337-43476359 TGTGGCTGTGCTGGTATCTAAGG + Intergenic
972902366 4:43700572-43700594 TGTGGCCATGTTGGTACCTAAGG + Intergenic
972928444 4:44040860-44040882 CGTGGCTGAGCTGATACTTAAGG - Intergenic
973053917 4:45630500-45630522 TGTGGCTGATCTGGTACATAGGG - Intergenic
973552751 4:52051828-52051850 AAGGGCTGTGCTGGAACCTATGG - Intronic
973852782 4:54977586-54977608 CTTGGCAGAGCTGGTACCTAGGG - Intergenic
974414963 4:61595164-61595186 TGTGGCTGAGCTGATAGCTGGGG + Intronic
974593251 4:63983335-63983357 TGTGGCTGAGCAGGTACCTGAGG + Intergenic
975095326 4:70450443-70450465 TGTGGCTGTGCTGGTACCTAAGG + Intronic
975313141 4:72925483-72925505 TGTGGCTGAGTTGGTATATAAGG + Intergenic
975365569 4:73524093-73524115 TGTGGCCAAACTGGTACCTAAGG + Intergenic
975375956 4:73645984-73646006 TATGGCTGAGCTGGTACCTAAGG + Intergenic
975502256 4:75099958-75099980 TGTGGCAGTGTTGGTACCTAAGG + Intergenic
975503857 4:75117030-75117052 TGTAGCTGAGCTGGTATCCAAGG - Intergenic
975592781 4:76017069-76017091 TGTGGCCGAGCTGGTACCTGTGG + Intronic
975629778 4:76388226-76388248 TGTGGCTGAGCTGGTACCTAGGG - Intronic
975641915 4:76509353-76509375 AGTAGCTGTGCAGGTACCTGGGG + Intronic
976254199 4:83083486-83083508 TGTGGCTGTGCTGGTACCTAAGG + Intergenic
976451862 4:85199626-85199648 TGTGGCTGTACTGGTTCCTAAGG + Intergenic
976525644 4:86084191-86084213 TGTGGCCAAGCTGGTACCTAAGG - Intronic
976728494 4:88239880-88239902 TGTTGCTGAGCTGGTACCTAAGG + Intergenic
977044409 4:92051220-92051242 TGTAGCTATGCTGGTATCTAAGG - Intergenic
977307463 4:95342675-95342697 TGTGGCTGAGTTGGTACTTAAGG - Intronic
977325695 4:95572311-95572333 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
977527830 4:98166080-98166102 TGTGGTTGAGCTGGTATCTAGGG + Intergenic
977744994 4:100535942-100535964 TGTGGCCATGCTGGTACCTAAGG - Intronic
978212658 4:106156860-106156882 TGTGGCTGAGTTGGTACCTAAGG + Intronic
978261737 4:106768305-106768327 TGTAGCTGAGCTGGTACCTATGG - Intergenic
978287817 4:107099127-107099149 TATGGCTGAGCTGGTACCTAAGG - Intronic
978661932 4:111137401-111137423 TGTGTCTGTGTTGGTACCTAAGG + Intergenic
979028041 4:115602326-115602348 TTTTGCTGTCCTGGTACCTAAGG + Intergenic
979213283 4:118132561-118132583 TGTGGCCAAGCTGGTACATAAGG + Intronic
979572995 4:122252300-122252322 TGTGGCTGTGCTGGCATCTAAGG - Intronic
979594995 4:122525188-122525210 TGTGGCAGTGTTGGTACCTAAGG + Intergenic
979878807 4:125928642-125928664 TGTGGCAGTGTTGGTACTTAAGG - Intergenic
980172397 4:129305740-129305762 TGTGGCCAAGCTGGTACCTAGGG + Intergenic
980412998 4:132447324-132447346 TGTGGCTGTGCTGGTGCCTGAGG - Intergenic
980442958 4:132871336-132871358 TGTGGCTGTGCTGGTATCTAAGG - Intergenic
980960563 4:139470532-139470554 TGTGGCCATGCTGGTACCAAAGG + Intronic
981298118 4:143156268-143156290 TGTGACTGTGCTGGTACCTAAGG + Intergenic
981530806 4:145752145-145752167 TGTGGTCAAGCTGGTACCTAAGG + Intronic
981871088 4:149486930-149486952 TGTGGCCAAGCTGGCACCTAAGG + Intergenic
982342391 4:154314998-154315020 TGTGGCTGTTTTGGCAACTAAGG - Intronic
982615304 4:157633769-157633791 TGTGGCAGTGTTGCTACATAAGG - Intergenic
983124546 4:163934219-163934241 TGTTGCTCTGCTGTTACATAGGG - Intronic
983165964 4:164477559-164477581 TGTGGCTGGGCTGGTACCTAAGG + Intergenic
983421725 4:167526946-167526968 TGTGGCTGTTCTAGTACTTAAGG + Intergenic
984108307 4:175577729-175577751 GGTAGCTGTGCTGGTATCTCTGG - Intergenic
985229490 4:187799393-187799415 TGTAGCCAGGCTGGTACCTAAGG - Intergenic
985444291 4:190012601-190012623 TCTGGCCTTGCTGGTACCTAAGG - Intergenic
986332476 5:6727513-6727535 TTGGGCTGTGCTGGTGCCTTTGG + Intronic
986492722 5:8308572-8308594 TGGAGCCCTGCTGGTACCTAAGG - Intergenic
986544450 5:8880105-8880127 TGTGGCTGAGCTGGTATCTAAGG + Intergenic
986657574 5:10030581-10030603 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
986756320 5:10839869-10839891 TGTAGCCGAGCTGGTACCTAAGG - Intergenic
986913454 5:12586025-12586047 TGTGGCTGAGCTGGTACCTGAGG + Intergenic
986941363 5:12954141-12954163 TATGGCTGTGCTGGTACCTAAGG - Intergenic
987496575 5:18652811-18652833 TGTGGCCAAGCTGGTATCTAAGG + Intergenic
987583020 5:19820420-19820442 TGTAGCTGTTGTGGCACCTATGG - Intronic
987823110 5:22991513-22991535 TGTGGCCCTGCTGGTACCTAAGG - Intergenic
987911706 5:24155217-24155239 TGTGGCTGAGCTGGTACCTAAGG - Intronic
988299404 5:29403540-29403562 TGTGGCCAAGCTGGTACCTGAGG - Intergenic
988314846 5:29611131-29611153 TGTGACTGTACTGGAACATAGGG - Intergenic
989434168 5:41391699-41391721 TGTGGCTCTGCTGGCACCTAAGG - Intronic
989489406 5:42032727-42032749 CGTGGCTGTGCTAGTACCTAAGG + Intergenic
989628970 5:43461436-43461458 TATGCCTGTGCTGATACCTAAGG - Intronic
989672614 5:43936315-43936337 TGTGGCTGACCTAGTACCTAAGG - Intergenic
989723143 5:44553515-44553537 CGTGGCTGGGCTGGTACCTAAGG + Intergenic
989970752 5:50521379-50521401 TGTGGCTGTGCTGGTACCTAAGG + Intergenic
990592889 5:57283684-57283706 CGTGGCTGAGCTGGTATGTAAGG - Intergenic
991018668 5:61958089-61958111 TGTGTTTGTGTTGGTACCTAAGG + Intergenic
991107462 5:62860934-62860956 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
991180594 5:63746770-63746792 TGTAGCCATGCTAGTACCTATGG + Intergenic
991663625 5:68974581-68974603 TGTGACTGTGCTGGTACCTAAGG - Intergenic
992587157 5:78252333-78252355 TGTGGCTGTACTGGTACCTAGGG - Intronic
993155664 5:84218872-84218894 TGTGGCTGAGCTGGCACAGAAGG - Intronic
993171065 5:84419635-84419657 TGTGGCAGAGCTGATAGCTATGG - Intergenic
993197250 5:84764657-84764679 TGTGGCCATACTGGTACCTAAGG + Intergenic
993207056 5:84895212-84895234 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
993580421 5:89653725-89653747 TGTGGCTGTGCTGGTACCTAAGG - Intergenic
994274711 5:97822043-97822065 TATGACTGAGCTGGTACCTAGGG + Intergenic
994343921 5:98663248-98663270 TGTGGCTGAGCTAGTACCTATGG - Intergenic
994477673 5:100291022-100291044 TGTGGTCATGCTGGTACCTGAGG + Intergenic
994616176 5:102107290-102107312 TGTGGCTGTGCTGGTACATAAGG + Intergenic
994633934 5:102320706-102320728 TGTGGCAGTGCTGGTACCTAAGG + Intergenic
994660012 5:102642003-102642025 TATAGATGAGCTGGTACCTAAGG - Intergenic
994845792 5:104987004-104987026 TGTGGCTGTGCTGGTACCTAAGG + Intergenic
995290261 5:110443583-110443605 TGTTGCCAAGCTGGTACCTAAGG + Intronic
995290617 5:110447297-110447319 TGTGGCTGTGCAGGAATGTAAGG - Intronic
995557548 5:113344940-113344962 TGTGGCTGAGCTGGTACCTGCGG - Intronic
996133398 5:119809432-119809454 TGTGGTGGTGTTGGTACCTAAGG + Intergenic
996210154 5:120798611-120798633 TGTGGCAGAGCTGGTACCTTTGG - Intergenic
996459540 5:123725508-123725530 TGTAGCCAAGCTGGTACCTAAGG - Intergenic
996594479 5:125185353-125185375 TGTGGCTGTGCAGGCATGTAAGG - Intergenic
996666568 5:126066733-126066755 TGTGGCCAAGCTGGTACCTAAGG - Intergenic
996961499 5:129255579-129255601 TGTGGCAGAGCTGATACCTAAGG + Intergenic
996968285 5:129331604-129331626 TGTGACTGAGCTGGTACCTATGG - Intergenic
997059847 5:130488179-130488201 TGTTGCTGAGCTGGTACCTAAGG - Intergenic
997186237 5:131884679-131884701 TGTGGCTGAGCTGGTATCTAAGG - Intronic
997470388 5:134114242-134114264 TGAGGCTGTGCTCGTACCCCAGG - Intergenic
997832657 5:137164564-137164586 TGTGGCCAAGTTGGTACCTAAGG - Intronic
998337151 5:141383400-141383422 TGGGGCTGAGCTGGTAACTCTGG - Exonic
998338230 5:141393314-141393336 TGGGGCTGAGCTGGTAGCTCTGG - Exonic
998339363 5:141403453-141403475 TGGGGCTGAGCTGGTAGCTCTGG - Exonic
998634016 5:143932289-143932311 TGTGACTGAACTAGTACCTAGGG - Intergenic
998716398 5:144889574-144889596 TGTGGCGGTTTTGGTACCTAAGG - Intergenic
999002527 5:147939750-147939772 TGTGGCCAAGCTAGTACCTAAGG + Intergenic
999301229 5:150491865-150491887 TGTGGCTGTCCTCGTAACCAGGG + Intronic
999785845 5:154889985-154890007 TGTGGAAGTGCTGGATCCTATGG + Intronic
999989032 5:157032647-157032669 TGTGGCAGAGCTGGTACAGAGGG - Intronic
1000399470 5:160811327-160811349 TGTAGCTGAGCTGGTACATAAGG - Intronic
1000478639 5:161744164-161744186 TGTGGCTGTGCTGGTACCTAAGG + Intergenic
1001322241 5:170692226-170692248 TTTGGCCGTGGTGGTACCTTAGG - Intronic
1002711958 5:181200627-181200649 TGGGGGTGTGCTGCTACCTCTGG - Intronic
1003437952 6:6111394-6111416 TGTGGCTGAGCTGGTACCAAAGG + Intergenic
1005157057 6:22819230-22819252 TGTGGTTGAGCTGGTACCTAGGG + Intergenic
1006003830 6:30987281-30987303 GGTGGCTGTGCTGGTCCCACTGG - Exonic
1006021623 6:31121025-31121047 TGTGGCTGGCCTGGTACTTGGGG - Intronic
1006504438 6:34479126-34479148 TGTGGCTGTGTTGGGAGGTAGGG - Intronic
1006800210 6:36754859-36754881 TGGGGCTCTACTGGTAGCTATGG + Intronic
1007206722 6:40158541-40158563 TGTTCCTGAGCTGCTACCTAAGG - Intergenic
1008017860 6:46541660-46541682 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1008312167 6:49989868-49989890 TGTGGGCATGCTGGTACCCAAGG - Intergenic
1008314702 6:50025885-50025907 TGCAGCTAAGCTGGTACCTAAGG - Intergenic
1008857947 6:56113711-56113733 CGTGGCAGTGTTGGTACCTAAGG - Intronic
1008880758 6:56378222-56378244 TGTGGCCAAGCTAGTACCTAAGG - Intronic
1009245456 6:61231738-61231760 TGTGGCAGTGTTGGTACCTAAGG - Intergenic
1009353152 6:62707567-62707589 TGTGGAGGAGTTGGTACCTAAGG + Intergenic
1009371169 6:62905373-62905395 TGTAGCTGAGCTGGTACCTAAGG - Intergenic
1009390732 6:63140354-63140376 TGTGGCTGTGCTGCTACCGGAGG - Intergenic
1009617610 6:66030918-66030940 TGTAGCTTTGCTGATACCTTTGG + Intergenic
1009771223 6:68145077-68145099 TCTGGCTGAGCTGGCACCTAAGG + Intergenic
1009782934 6:68293454-68293476 TATGGCCTTGCTGGTACCTGAGG - Intergenic
1009893794 6:69721706-69721728 TGTGGCTGAGCTGGTACCTGAGG - Intronic
1010328074 6:74588103-74588125 TGTGGCCTTTCTGGTACCTACGG - Intergenic
1010514132 6:76752992-76753014 TGTGGCTGAGCTGGTATCTAAGG - Intergenic
1010560278 6:77340666-77340688 TGTGGCTTAGCTGGTACCTAAGG + Intergenic
1010625325 6:78131496-78131518 TGTGGCTGTGCTGGTACCTAAGG - Intergenic
1010676663 6:78753690-78753712 CTTGGTTGAGCTGGTACCTAAGG - Intergenic
1010838817 6:80623417-80623439 TGTGGCCAAGCTGGTACCTAAGG - Intergenic
1011333225 6:86233555-86233577 TGTGGCTAAGCTGGTACCTAAGG + Intergenic
1011343251 6:86340609-86340631 TGTGGCTGAGTTGGTACCTAAGG - Intergenic
1011914614 6:92488237-92488259 TGTGACTGAGCAGGTACTTAAGG + Intergenic
1012049942 6:94328700-94328722 TATGGCTGTGCTGATAACTAAGG - Intergenic
1012059704 6:94462967-94462989 TGTGGCTGAGCTGGTATTCAAGG + Intergenic
1012091463 6:94902934-94902956 TGCGGCGATGCTGGTACCTAAGG - Intergenic
1012224499 6:96688792-96688814 TGTGGCCAAGCTGGTACCTGAGG - Intergenic
1012714283 6:102649019-102649041 TATGGCCATGCTGGTACGTAAGG - Intergenic
1013099441 6:106974754-106974776 TGTGGCTTTCCTGGTATATAAGG - Intronic
1013925621 6:115468288-115468310 TGTAGCAGTGTTGGTACCTGAGG + Intergenic
1014582978 6:123161539-123161561 CATGGCAGTGTTGGTACCTAAGG + Intergenic
1014865250 6:126521256-126521278 TGTGGTTGTGCTGGTACCTGAGG + Intergenic
1015030311 6:128586779-128586801 AGTGGCAGTGCTTGTACCTAAGG - Intergenic
1015052830 6:128862918-128862940 TGTGGCTGAGCTGGTATGTAGGG + Intergenic
1015538760 6:134294056-134294078 TGTGGCTGTGCAGATAGCTCAGG + Intronic
1015759941 6:136647890-136647912 TGGGACTGTGCTGGTTCCTGAGG - Intronic
1016151207 6:140745269-140745291 TGTGGCTGTACTGGTACTTAAGG - Intergenic
1016567479 6:145472413-145472435 CGTGGCTATGATGGTACCTAAGG - Intergenic
1018784207 6:167095476-167095498 TTTGGATGAGCTGGTATCTACGG + Intergenic
1018917619 6:168146407-168146429 TGTGGCTGAGCTGGGACCTAAGG + Intergenic
1020339170 7:7090714-7090736 TGTGGCTGTGCTCATATCTGTGG + Intergenic
1020573011 7:9890254-9890276 TGTGGCCAAGCTGGTACCTTAGG - Intergenic
1020624223 7:10558166-10558188 TGTGGCTGAACTGGTACCTAAGG - Intergenic
1021203570 7:17753209-17753231 TGTGGCTGAGCTGGTAACTAAGG + Intergenic
1021247947 7:18287769-18287791 TGAGGCTGTACTGGCCCCTAAGG + Intronic
1021353695 7:19628070-19628092 TGTGGCTGAGCTGGTATCCAAGG - Intergenic
1021382396 7:19983791-19983813 TGTGGCTATGCTGGCATCTAAGG + Intergenic
1021640983 7:22735850-22735872 TGTGGTGGTGTTGGTACCTAAGG - Intergenic
1022541970 7:31146019-31146041 TGTGGCCAAGCTGGTACCTAAGG + Intergenic
1022741134 7:33122723-33122745 TCTGGCTGAGCTGGTACCTAAGG + Intergenic
1022749873 7:33213479-33213501 TGTGGCCAAGCTGGTACCTAAGG + Intronic
1024145954 7:46516483-46516505 TGTGGCTTTGCTGGGTCATAAGG + Intergenic
1024891682 7:54211025-54211047 TGTGGCTATGCTGGTATTAAAGG - Intergenic
1024956510 7:54926735-54926757 TGTGGTTGAGCTGGTACTTAAGG - Intergenic
1025800271 7:64780246-64780268 TTTGGCCATGCTGGTACCTAAGG + Intergenic
1027685342 7:81273677-81273699 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1028001368 7:85502111-85502133 TGTGGCTGAGCTGGTTCTTAAGG - Intergenic
1028160932 7:87483927-87483949 TGTGGCCGAATTGGTACCTAAGG - Intergenic
1028207548 7:88034041-88034063 TGTGGCCAAACTGGTACCTAAGG + Intronic
1028264454 7:88705634-88705656 TGTGGTCGTGCTGTTACCTATGG + Intergenic
1028307968 7:89290363-89290385 TGTGGCTGGGATGGTGCCTAAGG - Intronic
1028339045 7:89695185-89695207 TGTGACCATGCTAGTACCTAAGG - Intergenic
1029797312 7:102909395-102909417 TGTGGCCGTGCTGGTATCTAAGG + Intronic
1030222455 7:107110919-107110941 TGTGGCTGAGCTAGTACCTAAGG - Intronic
1030408324 7:109143147-109143169 TGTGGTGGTCTTGGTACCTAAGG + Intergenic
1030408376 7:109143503-109143525 TGTGGCTGAGCTGGTATTCAAGG + Intergenic
1030431599 7:109455545-109455567 TGTGACCAAGCTGGTACCTATGG + Intergenic
1030629454 7:111879470-111879492 TGTGACTGAGCTGGTACCTAAGG - Intronic
1031280787 7:119797151-119797173 TGTGGCTATGTTGACACCTAAGG + Intergenic
1031442566 7:121812150-121812172 TGTGGCTGAGCTGGTGCCTAAGG - Intergenic
1031565934 7:123296908-123296930 TGTGGCTGAGCTGGTACCCAAGG - Intergenic
1031702489 7:124943030-124943052 CATGGCTGTGCAAGTACCTATGG - Intergenic
1032939140 7:136768373-136768395 TGTGGCCCAGCTGGTACATAAGG - Intergenic
1033426686 7:141251097-141251119 TGTGGCTCTGCTGGGCCCTGAGG + Intronic
1033691327 7:143740426-143740448 TGTGGCCATGCTGGTACCTAAGG - Intergenic
1034594027 7:152171054-152171076 TTTGGCTGTGCTGATAGATAAGG + Intronic
1035084517 7:156246908-156246930 TGTGGCTGAGCTGGTCTCTAAGG + Intergenic
1035988667 8:4463393-4463415 TGTGGATTTGCTGGTTCATATGG - Intronic
1037295637 8:17397221-17397243 TATGGCTGAGCTAGTACCTGAGG - Intronic
1037302963 8:17472269-17472291 TGTAGCTGTGCTAGTATCTCTGG - Intergenic
1037586470 8:20280131-20280153 TGGGGTTGGGGTGGTACCTAAGG - Intronic
1039002337 8:32995381-32995403 TGTGGATGCGCTGGTACCTAAGG + Intergenic
1039282102 8:35997195-35997217 CATGGCCATGCTGGTACCTAAGG + Intergenic
1039371058 8:36984308-36984330 TTTGGCTGTGCTGGTAATTATGG + Intergenic
1039647454 8:39303363-39303385 TGTGGTTGAGCTGGTACCTAAGG + Intergenic
1040095704 8:43440461-43440483 TGTGGCCATGCTAGTACCTAAGG - Intergenic
1040511494 8:48100148-48100170 TGTGGCCTAGCTGGTACCTAAGG + Intergenic
1040628149 8:49175755-49175777 TGTGGCCAAGCTGCTACCTAAGG - Intergenic
1040743125 8:50604741-50604763 TGTGGCTGAGCTGGTTTCTAGGG + Intronic
1041579908 8:59446869-59446891 TGTGGCCAAGCTGGTACCTAAGG + Intergenic
1041869256 8:62614995-62615017 TGAGGCTCTGCTGGTACCTAAGG + Intronic
1042082539 8:65071067-65071089 TGTGGCCAAGCTGGTACCTAAGG + Intergenic
1042726863 8:71888378-71888400 TGTGGCCATACTGGTACCTAGGG + Intronic
1042898392 8:73695607-73695629 TGTGGCTGAGCTGGTACCTAGGG - Intronic
1043366856 8:79543023-79543045 TGTGGCTGTGCTGGTGCCTAAGG - Intergenic
1043600334 8:81929421-81929443 TGTGGATGAGCTGGTACCTAGGG - Intergenic
1043998011 8:86843193-86843215 TGTGGCCGAGCTGGTACAAAAGG - Intergenic
1044026170 8:87175237-87175259 TGTGGCCAAGCTGGTATCTAAGG + Intronic
1044193062 8:89342523-89342545 TGTGGTTGAGCTCGTACCTAAGG + Intergenic
1044282532 8:90373195-90373217 TGTGGCTGTGTTGGGAGATAGGG + Intergenic
1045589948 8:103582436-103582458 TGTGGCTATGTTGGCACCTAAGG - Intronic
1045599022 8:103692742-103692764 TGTGGCTGAGCTGGTATCCAAGG + Intronic
1045621222 8:103980575-103980597 TGTGGCTGAGCTGACATCTAAGG - Intronic
1045994864 8:108351362-108351384 TGTGGCTGAGCTGGTATCCAAGG - Intronic
1046114149 8:109765227-109765249 TGTGGCCAAGCTGGTACCTGAGG + Intergenic
1047089431 8:121557347-121557369 TGTGGCTGTGCTGAGGCCTCTGG - Intergenic
1047901099 8:129423197-129423219 TGTGGCTAAGCTGGTACCTAAGG - Intergenic
1048646671 8:136428438-136428460 TGTGGCTAAGCTGGTATATATGG - Intergenic
1049222622 8:141434860-141434882 AGTGGCTGTGCAGGTAGCTGAGG + Intergenic
1050248185 9:3713841-3713863 TGTGGCCAAGCTGGTACATAGGG - Intergenic
1050315957 9:4401062-4401084 TGTGGCTGAGCTGGTGCCTAAGG - Intergenic
1050355870 9:4782202-4782224 TGTGACTGAGCTGGTACATAAGG - Intergenic
1050578731 9:7028083-7028105 TGTGGCCAAGCTGGTACCTAAGG + Intronic
1050644292 9:7702499-7702521 TGTGGCTGAGCTGGTACCTCAGG + Intergenic
1050721980 9:8600914-8600936 TATGGCTGAGCTGGTACCTCAGG - Intronic
1050913951 9:11108071-11108093 TGTGGCTGGCCTGGTACTTCAGG - Intergenic
1051047206 9:12889046-12889068 CGTGGCTGAGTTGATACCTAAGG - Intergenic
1051465064 9:17367995-17368017 TGTGGATGAGCTGGTACCTAAGG - Intronic
1051478817 9:17537899-17537921 TGGGGCTGAGCTTGTGCCTATGG - Intergenic
1051704327 9:19860592-19860614 TGTAGCTGAGCTGGTTCCTAAGG - Intergenic
1051909757 9:22139747-22139769 TGTGGCAGTGGTGGTTCCTTTGG - Intergenic
1051923790 9:22298995-22299017 TGTGGCCATGTTAGTACCTAAGG + Intergenic
1051992087 9:23163568-23163590 TGTGGCCTAGCTGGTACCTAAGG - Intergenic
1052585663 9:30424889-30424911 TATGGGTGAGCTAGTACCTAAGG + Intergenic
1052766956 9:32650991-32651013 CTTGGCTTTTCTGGTACCTAGGG - Intergenic
1053150184 9:35738322-35738344 TGTGGCTGTGATGGTCCAGATGG - Exonic
1053175236 9:35917723-35917745 TGTGGCTGTGCCTGTATCTCAGG - Intergenic
1053204441 9:36174209-36174231 TGTGGCCAAGCTGGTACCTAAGG - Intergenic
1054842364 9:69756995-69757017 TGTGTCTGTGCTGTTCCATATGG - Intronic
1055227362 9:74015355-74015377 TGTGGTTTAGCTGGTAGCTATGG - Intergenic
1055301989 9:74891828-74891850 TGTGGTTGAGCTGGTATCCAAGG - Intergenic
1055339249 9:75263758-75263780 TGTGGTGATGGTGGTACCTATGG + Intergenic
1055636264 9:78282128-78282150 TCTGGCTGTGCTGCGCCCTAGGG + Intergenic
1055886474 9:81069416-81069438 TGTGGCTGAGTTGGTACCTAAGG + Intergenic
1056424700 9:86464958-86464980 TGTGGCAAAGCTGGTACCTAAGG + Intergenic
1056957290 9:91092437-91092459 TGTGGCTGTGCGGTTACCTAAGG - Intergenic
1058226521 9:102371305-102371327 TGTGGCCATGCTGGTACCTAAGG + Intergenic
1058767814 9:108198860-108198882 TGTGGCTATGATGGTACCTAAGG - Intergenic
1058780170 9:108325348-108325370 TGTGGCCATGCTGGTACTTGAGG - Intergenic
1059352621 9:113676465-113676487 TTTGGCTGTGCTGGTTCACAAGG + Intergenic
1059900669 9:118921653-118921675 TGTGGCTGAGCTGGTATCAAAGG + Intergenic
1061638282 9:131929370-131929392 TGTAGCCAAGCTGGTACCTAAGG - Intronic
1062715722 9:138009182-138009204 GGTGCCTGTGCCGGTACCTGTGG + Intronic
1186047876 X:5555866-5555888 TGTGGCTTTGCTATTGCCTAAGG - Intergenic
1186607094 X:11103425-11103447 TGTGGCAGTGCTGGGAGCTGGGG - Intergenic
1187579319 X:20591704-20591726 TGTGGCTGAGCTGACACCTAAGG + Intergenic
1187588483 X:20689966-20689988 TGTGGATGAGCTGGTACCTAGGG + Intergenic
1187594470 X:20756152-20756174 TGTGGCTCAGCTGGTACCTAAGG + Intergenic
1187610587 X:20939039-20939061 CATGGCCATGCTGGTACCTAAGG + Intergenic
1187618699 X:21027008-21027030 CGTGGCCGAGCTGGTACCTAAGG + Intergenic
1187623578 X:21085985-21086007 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1187636820 X:21238436-21238458 TGTGGCTGAGCTGGGACCTAAGG - Intergenic
1187652063 X:21420398-21420420 TATGCATGAGCTGGTACCTAAGG + Intronic
1187836176 X:23434682-23434704 TGTGGCTGAGCTGGTGTCCAAGG - Intergenic
1187844921 X:23525205-23525227 TGTGGCTGAGCTGGTACCTTAGG - Intergenic
1188040550 X:25366395-25366417 TGTGGCAGTGCTGGTACCTAAGG + Intergenic
1188108255 X:26167812-26167834 TGTGATGGTGCTGGTACCTAAGG + Intergenic
1188116539 X:26251114-26251136 TGTGGCCGAGGTGGTACCTAAGG - Intergenic
1188140798 X:26548185-26548207 TGTGGCCATGCTGGTGTCTAAGG + Intergenic
1188210586 X:27419191-27419213 TGTAGCTGAGCTGGTATCCAAGG - Intergenic
1188578995 X:31687315-31687337 TGTGGCTGAGCTGGTACCTAAGG - Intronic
1188716444 X:33464587-33464609 TGTGGCTGAGCTGGTATCCAAGG + Intergenic
1188721522 X:33528587-33528609 TGTGGCTGAGTTGGTATCTAAGG + Intergenic
1188742966 X:33809042-33809064 TGCAGCTGAGCTGGTACCTAAGG + Intergenic
1188917860 X:35934556-35934578 TGTGGCCAAGCTGATACCTAAGG + Intronic
1188924622 X:36023954-36023976 TGTTGCTGACCTGGTACCTAAGG + Intergenic
1188926071 X:36045317-36045339 TGTGGCTGTGCTGGTACCTCAGG + Intronic
1188943055 X:36263764-36263786 TGTGGCCATGCTGGTACCTAAGG + Intronic
1189013449 X:37070900-37070922 TGTGGTTGAGCTCGTACCTAAGG + Intergenic
1189197238 X:39162588-39162610 TGTGGCTCTGCTGGGACCTCTGG - Intergenic
1189222421 X:39383803-39383825 GGTGGGTGGGATGGTACCTAAGG + Intergenic
1189405733 X:40721143-40721165 TTTGGCTGAGCTGGTACCTAAGG - Intronic
1189593851 X:42543614-42543636 TATGGCCAAGCTGGTACCTAAGG - Intergenic
1189670218 X:43400491-43400513 TGTGGCAGTGTTGGTACCTAAGG - Intergenic
1189858444 X:45247745-45247767 TGTGACAGTGTTGGTACCTAAGG + Intergenic
1189868785 X:45360509-45360531 TGTGGCTGAGTTGGTACTTAAGG + Intergenic
1190374343 X:49774637-49774659 TGTGGCCGAGCTGCTACCTAAGG + Intergenic
1190498596 X:51053258-51053280 TATGGCTGAGCTGGTACCTAAGG + Intergenic
1190523013 X:51299194-51299216 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1190537758 X:51446611-51446633 TGTGGCCAAGCTGGTACCTAAGG + Intergenic
1190537814 X:51446966-51446988 TGTGGCCGAGCTGGTATCCAAGG + Intergenic
1190614591 X:52217443-52217465 TGTGGCCAAGCTGGTACCTAAGG - Intergenic
1191048855 X:56169344-56169366 TGTGGCCAAGCTGGTACCTAGGG - Intergenic
1191052703 X:56211820-56211842 TGTGGCCATGCTGGTACCTGAGG + Intergenic
1191054451 X:56227805-56227827 TATGGGTGTGGTGGTATCTAGGG + Intergenic
1191650281 X:63529619-63529641 TGTGGCTATGCTGGTACCTAAGG - Intergenic
1191694613 X:63977325-63977347 TTTGGCTGTGCTGGTACCTATGG - Intergenic
1191700661 X:64038510-64038532 TGTGGCTGAGCTGATACCGAAGG - Intergenic
1191703755 X:64070999-64071021 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1191774831 X:64802367-64802389 TGTGGTGGTGTTGGTACCTAAGG - Intergenic
1191826873 X:65375587-65375609 TGTGGCTGAGCTGGTATTCAAGG - Intronic
1191826931 X:65375943-65375965 TGTGGCCAAGCTGGTACCTAAGG - Intronic
1191910298 X:66143044-66143066 TGTGTCTGAGCTGGTACCTAAGG + Intergenic
1191924540 X:66295614-66295636 TGTGTCTGTGCTGGTACCTAAGG + Intergenic
1191943566 X:66504886-66504908 TGTCACTGCGCTTGTACCTAAGG - Intergenic
1191946925 X:66544563-66544585 TGTGGCCAAGCTGGTACCTAAGG + Intergenic
1191949389 X:66572015-66572037 TGTGACAGTGTTGGTACCTGAGG + Intergenic
1191967516 X:66776433-66776455 TATGGCTGTGCTCGTGCCTAAGG + Intergenic
1191972561 X:66833076-66833098 CGTGGCTGTGCTGGTACATAAGG - Intergenic
1191984088 X:66959819-66959841 TGTGGCCATGCTGGCATCTAAGG + Intergenic
1192001783 X:67159083-67159105 TGTGTCCCTGCTGGTACCTAAGG - Intergenic
1192073176 X:67962447-67962469 TATGGCTGAGCTGTTACCTGAGG - Intergenic
1192135056 X:68589316-68589338 TGTGGCCGAGTTAGTACCTAGGG - Intergenic
1192380808 X:70614192-70614214 TGTGGCTGAGCTGGTACCTAAGG - Intronic
1192812562 X:74560129-74560151 TGTGGCTGTGCTGGCATCTAAGG - Intergenic
1192822407 X:74658601-74658623 GGTGGCTGTGCTGGTACCTAAGG + Intergenic
1192826724 X:74704717-74704739 TGTGGCCAAGCTGGTGCCTAAGG + Intergenic
1192853290 X:74980582-74980604 TGGGGCCATGCTGGTACCTATGG - Intergenic
1192863758 X:75107846-75107868 TGTGGCTGTGCTGGTACCTAAGG - Intronic
1192995457 X:76507618-76507640 TGTGGCCAAGCTGGTACCTATGG + Intergenic
1193063585 X:77233407-77233429 TCTGGCTGAGCTGGTACCTAAGG - Intergenic
1193161885 X:78237856-78237878 TGTGCCTGTGCTGGTACCTAAGG + Intergenic
1193167873 X:78302412-78302434 TCTGGCTGAGCTGGTACCTGAGG + Intronic
1193175166 X:78384255-78384277 TGTGGCCATGCTGATCCCTAAGG - Intergenic
1193204845 X:78736365-78736387 TGTGGCCATGCTGGTATGTAAGG + Intergenic
1193242984 X:79194799-79194821 TGTGGCTATGCTGGTACCTAAGG - Intergenic
1193246162 X:79232416-79232438 TTTGGCTGAGCTGGTTCCTAAGG + Intergenic
1193297143 X:79846514-79846536 TGTTGCTGAGCTTGTACTTAAGG + Intergenic
1193300004 X:79878738-79878760 TGTGGTTATACTGGTACCTAAGG - Intergenic
1193305794 X:79949771-79949793 TGTGGTTGAGTTGGTACCTAAGG - Intergenic
1193396592 X:80990904-80990926 TGTGGCTGAGCTAGTTCCTAAGG - Intergenic
1193409012 X:81140809-81140831 CGTGGCCATGCTGGTAACTAAGG - Intronic
1193487327 X:82102744-82102766 TGTTGCCATGCTGGTACGTAAGG + Intergenic
1193561468 X:83022680-83022702 GGTGGCCAAGCTGGTACCTAAGG - Intergenic
1193563417 X:83047897-83047919 TGTGGCTGAGCTGATATCCAAGG + Intergenic
1193580510 X:83258216-83258238 TGTGACCGAGCTGGTACCTAAGG - Intergenic
1193650312 X:84123332-84123354 TGTGGCTGAGCTGGTACCTAAGG - Intronic
1193665420 X:84310129-84310151 TGTGGCTGTGCTGGTACCTAAGG - Intergenic
1193683727 X:84552687-84552709 TGTGGCAGTGTTCATACCTAAGG + Intergenic
1193697248 X:84724051-84724073 TGTGGCTGTGCTGGTACCTAAGG + Intergenic
1193755895 X:85408409-85408431 CATGGCTGAGCTGGTACCTAAGG + Intergenic
1193815734 X:86102656-86102678 TGTGGTTGTGCTTGTACTTAAGG - Intergenic
1193830940 X:86288880-86288902 TGTGACAGAGCTGGTACCTAAGG + Intronic
1193876585 X:86869215-86869237 TGTGGCAGTGGTGGTATCTAAGG + Intergenic
1193907585 X:87261706-87261728 TGTGGCAGTTTTGGTACCTAAGG - Intergenic
1193917120 X:87379170-87379192 TATGGCCCAGCTGGTACCTAAGG - Intergenic
1193931796 X:87562148-87562170 TGTGACTGAGCTGGTACTCAAGG - Intronic
1193981647 X:88188022-88188044 TGTGACTGCACTGGTACCTAAGG - Intergenic
1193986808 X:88252622-88252644 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1194110223 X:89824604-89824626 CGTGGCTGAGCTGGTACCTGAGG - Intergenic
1194219613 X:91175128-91175150 TGTGGCTGAGCTGCTACCTAGGG + Intergenic
1194265047 X:91743364-91743386 TGTGGCCATGCTGTTACCTAAGG + Intergenic
1194288535 X:92039711-92039733 TGTGGATAAGCTGATACCTAAGG + Intronic
1194291064 X:92072288-92072310 TGTGGCCAAGCTGGTACCTAGGG + Intronic
1194348297 X:92793675-92793697 TGTGGCCATGCTGGTGCCTAAGG - Intergenic
1194372503 X:93091223-93091245 TGTGGTGGTGTTGGTATCTAAGG + Intergenic
1194389027 X:93293257-93293279 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1194389211 X:93295060-93295082 TGTGGCTGAGCTGTTATCCAGGG - Intergenic
1194391372 X:93321801-93321823 TGTAGCTTTGCTTGTATCTAAGG + Intergenic
1194396698 X:93395235-93395257 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1194398465 X:93414501-93414523 TTTGACTGAGCTGGTACCTAAGG - Intergenic
1194415492 X:93606546-93606568 TGTGCCCGAGGTGGTACCTAAGG - Intergenic
1194476886 X:94369487-94369509 TGTGGCCACGTTGGTACCTATGG - Intergenic
1194495574 X:94613284-94613306 TGTGGTTGTGCTGGTACCTAAGG + Intergenic
1194530735 X:95045378-95045400 TGTGCCTGAGCTGATACCTAAGG - Intergenic
1194532474 X:95068697-95068719 TGTGGTTGAGCTGGTACCCAAGG - Intergenic
1194532518 X:95069055-95069077 TGTGTTTGAGCTGGTACCTAAGG - Intergenic
1194558208 X:95388728-95388750 TGTGGCCATGCTGGTACCTAAGG + Intergenic
1194558610 X:95393681-95393703 TATGGCTGAGCTGGTGCCTAAGG - Intergenic
1194561567 X:95428096-95428118 TGTGGCTGTGCTGGTACCTAAGG - Intergenic
1194568438 X:95522593-95522615 TGTGGCCATGCTTGTACCTAAGG - Intergenic
1194595164 X:95848297-95848319 TGTGGTGGTGTTGGTATCTAAGG - Intergenic
1194605887 X:95976975-95976997 TGTTGCTATGCTGGTACTTAAGG - Intergenic
1194623609 X:96202340-96202362 TGTAGTTGTGCTGGTCCTTAAGG - Intergenic
1194780776 X:98023138-98023160 TGTGGCTGAGCTAGTATCTAGGG + Intergenic
1194788727 X:98119049-98119071 TGTGGCTGTGCTGGTACCTAAGG - Intergenic
1194791796 X:98159958-98159980 TGTAGTCATGCTGGTACCTAAGG - Intergenic
1194795882 X:98210727-98210749 TGTGGCCAAGCTGGTACCTGAGG - Intergenic
1194839781 X:98726275-98726297 TGTTGCCATGCTGGTAACTAAGG + Intergenic
1194841966 X:98754004-98754026 TATGGCTGGGCTGGTACCTAAGG + Intergenic
1194882779 X:99274310-99274332 TGTGGCTTAGCTAATACCTAAGG - Intergenic
1194892275 X:99394750-99394772 TGTGGCTGAGCTGGTATCTAAGG + Intergenic
1194892548 X:99398137-99398159 TGTGGCTTAGCTGGTGCCTAAGG + Intergenic
1195014659 X:100766320-100766342 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1195115757 X:101696505-101696527 TGTGGCCGAGCGTGTACCTAAGG - Intergenic
1195122944 X:101775063-101775085 TGTAGTCATGCTGGTACCTAAGG + Intergenic
1195136209 X:101909419-101909441 TGTGGTGGTGTTGGTACCTAAGG - Intronic
1195199364 X:102532938-102532960 TGTGGCCAAGCTGGTACCTAAGG - Intergenic
1195502085 X:105613477-105613499 TGTGGCTGAGGTGGTATCTAAGG - Intronic
1195614502 X:106901876-106901898 TGTGGCAGTGCTGGTGCTTGAGG - Intronic
1195807840 X:108795638-108795660 TGTGGCCATGCTGGTACCTGTGG + Intergenic
1195821171 X:108946613-108946635 TGTGGCCGAGCTGGTATCTAAGG + Intergenic
1195834892 X:109102928-109102950 ATGGGCTGTGCTGGTACCTAAGG + Intergenic
1195971515 X:110478280-110478302 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1196154028 X:112407151-112407173 TGTGGCTGAGCTGGTTCCTTAGG - Intergenic
1196182128 X:112703846-112703868 TGTGACCAAGCTGGTACCTAAGG + Intergenic
1196304650 X:114087182-114087204 TGTGGATGTGCTGGTACATAAGG - Intergenic
1196461375 X:115935400-115935422 TGTGGTTGACCTGGTTCCTAAGG + Intergenic
1196485589 X:116203360-116203382 TGTGGCTCAGCTGGTACCTAAGG + Intergenic
1196494350 X:116306921-116306943 TATGGCCGAGCTGGTACCTAAGG + Intergenic
1196495361 X:116318190-116318212 TGTGGCCAAGCTCGTACCTAAGG - Intergenic
1196523828 X:116707647-116707669 TGTGGCCAAGCTGGTACCTAAGG + Intergenic
1196552511 X:117045818-117045840 GGTGGCCAAGCTGGTACCTAGGG - Intergenic
1196576660 X:117326011-117326033 TGTGGCTGAGCTGGCACCTAAGG + Intergenic
1196609575 X:117695877-117695899 TGTGGCCCTGCTGGAACCTAAGG - Intergenic
1196619664 X:117807435-117807457 TGCAGCTGAGCTGGCACCTAAGG - Intergenic
1196980587 X:121209268-121209290 TGTGGCTGACCTGGTACCTAAGG + Intergenic
1196984537 X:121253798-121253820 TGTGGCCTTGCTGGTACCTGAGG + Intergenic
1197072929 X:122322171-122322193 TGTGGCCAAGTTGGTACCTAGGG - Intergenic
1197096684 X:122604631-122604653 TGTGGCCATGCTGGTACCTAAGG - Intergenic
1197112870 X:122797411-122797433 TGTTGCTGAGCTAGTATCTACGG - Intergenic
1197112929 X:122797769-122797791 TGTGCCCGTGCTGGTACCTAAGG - Intergenic
1197139123 X:123096831-123096853 TGTGACTGAGATGGTACCTAAGG - Intergenic
1197373598 X:125655210-125655232 TGAGGCTGTCCTGGTTCCTGGGG + Intergenic
1197375997 X:125682544-125682566 TGTGGCCAAGCTGATACCTAAGG - Intergenic
1197429443 X:126342536-126342558 TATGGCTGTGCTGGTACATAAGG - Intergenic
1197437986 X:126456101-126456123 TGTGGCTGTGCTGGTATGTAAGG - Intergenic
1197492002 X:127129166-127129188 TGTGGCAGTGTTGGTACCTGAGG - Intergenic
1197520383 X:127490091-127490113 TGTGTCTGAGCTGATGCCTAAGG + Intergenic
1197520525 X:127491183-127491205 TGTGGCTGACCTGGTATCCAAGG + Intergenic
1197600372 X:128520411-128520433 TGAGGCCAAGCTGGTACCTAAGG - Intergenic
1197602619 X:128548065-128548087 TGTGGCACAGCTGGTACCTAAGG + Intergenic
1197810836 X:130441677-130441699 TGTGGCTGTGCTGGTACCTAAGG + Intergenic
1197987153 X:132278631-132278653 TGTGGCCATGCTGGTACCTAAGG + Intergenic
1198293026 X:135257171-135257193 ACTGGCTGAGCTGGTACTTAGGG - Intronic
1198363857 X:135921811-135921833 TCTTGCTGTGCTGGTACATGGGG + Intergenic
1198430812 X:136564718-136564740 TGTGGCTGAGCTGTTACCTAAGG + Intergenic
1198515255 X:137400560-137400582 TGTGACTAAGCTGGTACCTAAGG + Intergenic
1198537574 X:137601475-137601497 TATGGCTGAGCTGGTACCTAAGG - Intergenic
1198586056 X:138123744-138123766 TGTGACTGTGCTGGTAAATAAGG + Intergenic
1198611993 X:138411783-138411805 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1198694869 X:139325098-139325120 TGTGGTTGTGCTAGTACCTAAGG - Intergenic
1198697236 X:139354941-139354963 TGTAGCTGAGCAGGTACCTAAGG + Intergenic
1198702567 X:139413769-139413791 TGTGGCCAAGCTGGTACCTAAGG + Intergenic
1198761781 X:140040152-140040174 TATGGCTGAGCTGGTATCTAAGG + Intergenic
1198770577 X:140126096-140126118 TGTGGCTGAGCTGGTACCTAAGG + Intergenic
1198773552 X:140155978-140156000 TATGGCTGAGCTAGTACCTAAGG - Intergenic
1198925594 X:141788285-141788307 TCTGGCTGTGCTGGTATCTACGG + Intergenic
1198927454 X:141814848-141814870 TCTGGCTGTGCTGGTACCTAAGG + Intergenic
1199036172 X:143053262-143053284 TGTGGCCATGCTGGTACATAAGG + Intergenic
1199037050 X:143063930-143063952 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1199133151 X:144218956-144218978 TGTGGCTGATCTGGTATCCAGGG + Intergenic
1199135386 X:144244097-144244119 TGTGGCTCAGGTGGTATCTAAGG - Intergenic
1199159918 X:144596958-144596980 CGTGGCCGAGCTGGTACATAAGG + Intergenic
1199162367 X:144628419-144628441 TCTGGCGGTGTTGGTACCTCAGG - Intergenic
1199173607 X:144758832-144758854 TGTGGCCATGCTGGTACCTAAGG - Intergenic
1199239147 X:145526388-145526410 TGTGGCCATGCTGGTACCTAAGG - Intergenic
1199274637 X:145926631-145926653 TGTGACTGAGGTGGTGCCTAAGG - Intergenic
1199308679 X:146297486-146297508 TGTGGCCATGCTGGTACCTAAGG + Intergenic
1199334323 X:146600573-146600595 TGAGGCTGAGCTGGTACCTAAGG + Intergenic
1199358322 X:146886764-146886786 TGTGGCCTTGCTGGTACCTAAGG - Intergenic
1199374253 X:147088409-147088431 CGTGGCCATGCTGGTACCTAAGG + Intergenic
1199439649 X:147854104-147854126 TGTGGCTGTGTTGATACCTAAGG + Intergenic
1199440975 X:147867295-147867317 TGTGGCCGTGCTGGTAACGAAGG - Intergenic
1199485103 X:148338547-148338569 TGTGGCTGAGCTGGTACCCAAGG - Intergenic
1199645755 X:149909377-149909399 TGTGGCTGAGCTGGTACCTAAGG - Intergenic
1200315877 X:155132766-155132788 TGTAGCTGAGCTGGTACCTAAGG - Intronic
1200364274 X:155644835-155644857 TGTGGCTGAACTGATACCTAAGG + Intronic
1200369979 X:155715074-155715096 TGTGGCTGAGCTAGTACCTGGGG + Intergenic
1200370530 X:155719944-155719966 TGTGGCTGAGCTGGTACCTCCGG - Intergenic
1200462883 Y:3479345-3479367 CGTGGCTGAGCTGGTACCTGAGG - Intergenic
1200556124 Y:4638892-4638914 TGTGGCTGAGCTGCTACCTAGGG + Intergenic
1200582198 Y:4963810-4963832 TGTGGCCATGCTGTTACCTAAGG + Intergenic
1200606054 Y:5264276-5264298 TGTGGCTAAGCTGATACCTAAGG + Intronic
1200608573 Y:5296863-5296885 TGTGGCCAAGCTGGTATCTAGGG + Intronic
1200656624 Y:5910303-5910325 TGTGGCCATGCTGGTGCCTAAGG - Intergenic
1200680544 Y:6205266-6205288 TGTGGTGGTGTTGGTATCTAAGG + Intergenic
1201753795 Y:17465291-17465313 TGAGGCTGTGCTGCTACATTGGG - Intergenic
1201760869 Y:17536806-17536828 TGTGGCTGAGCTGGTATATGAGG + Intergenic
1201840683 Y:18369184-18369206 TGTGGCTGAGCTGGTATATGAGG - Intergenic
1201847757 Y:18440694-18440716 TGAGGCTGTGCTGCTACATTGGG + Intergenic
1202042656 Y:20701446-20701468 TGTGGCTGGGCTGATACCTAAGG - Intergenic
1202335745 Y:23809230-23809252 TGAGGCTGTGCTGCTACATTGGG - Intergenic
1202535022 Y:25860837-25860859 TGAGGCTGTGCTGCTACATTGGG + Intergenic