ID: 913706915

View in Genome Browser
Species Human (GRCh38)
Location 1:121434525-121434547
Sequence TCCCTCTGCTGTGGCTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913706915_913706924 22 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706924 1:121434570-121434592 GGATCCCCAATTCCAGGACTTGG No data
913706915_913706917 -8 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706917 1:121434540-121434562 CAGAGGGACAGAGAACCAAGTGG No data
913706915_913706923 16 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706923 1:121434564-121434586 GTCTTGGGATCCCCAATTCCAGG No data
913706915_913706920 0 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706920 1:121434548-121434570 CAGAGAACCAAGTGGGGTCTTGG No data
913706915_913706919 -6 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706919 1:121434542-121434564 GAGGGACAGAGAACCAAGTGGGG No data
913706915_913706918 -7 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706918 1:121434541-121434563 AGAGGGACAGAGAACCAAGTGGG No data
913706915_913706921 1 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706921 1:121434549-121434571 AGAGAACCAAGTGGGGTCTTGGG No data
913706915_913706928 29 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706928 1:121434577-121434599 CAATTCCAGGACTTGGCTCTTGG 0: 15
1: 66
2: 159
3: 315
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913706915 Original CRISPR TCCCTCTGCTGTGGCTGTGC TGG (reversed) Intergenic
No off target data available for this crispr