ID: 913706916

View in Genome Browser
Species Human (GRCh38)
Location 1:121434534-121434556
Sequence GGTTCTCTGTCCCTCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913706916_913706920 -9 Left 913706916 1:121434534-121434556 CCACAGCAGAGGGACAGAGAACC No data
Right 913706920 1:121434548-121434570 CAGAGAACCAAGTGGGGTCTTGG No data
913706916_913706924 13 Left 913706916 1:121434534-121434556 CCACAGCAGAGGGACAGAGAACC No data
Right 913706924 1:121434570-121434592 GGATCCCCAATTCCAGGACTTGG No data
913706916_913706923 7 Left 913706916 1:121434534-121434556 CCACAGCAGAGGGACAGAGAACC No data
Right 913706923 1:121434564-121434586 GTCTTGGGATCCCCAATTCCAGG No data
913706916_913706928 20 Left 913706916 1:121434534-121434556 CCACAGCAGAGGGACAGAGAACC No data
Right 913706928 1:121434577-121434599 CAATTCCAGGACTTGGCTCTTGG 0: 15
1: 66
2: 159
3: 315
4: 625
913706916_913706921 -8 Left 913706916 1:121434534-121434556 CCACAGCAGAGGGACAGAGAACC No data
Right 913706921 1:121434549-121434571 AGAGAACCAAGTGGGGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913706916 Original CRISPR GGTTCTCTGTCCCTCTGCTG TGG (reversed) Intergenic
No off target data available for this crispr