ID: 913706917

View in Genome Browser
Species Human (GRCh38)
Location 1:121434540-121434562
Sequence CAGAGGGACAGAGAACCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913706915_913706917 -8 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706917 1:121434540-121434562 CAGAGGGACAGAGAACCAAGTGG No data
913706912_913706917 1 Left 913706912 1:121434516-121434538 CCTTAGGTACCAGCACAGCCACA 0: 20
1: 95
2: 164
3: 271
4: 391
Right 913706917 1:121434540-121434562 CAGAGGGACAGAGAACCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913706917 Original CRISPR CAGAGGGACAGAGAACCAAG TGG Intergenic
No off target data available for this crispr