ID: 913706921

View in Genome Browser
Species Human (GRCh38)
Location 1:121434549-121434571
Sequence AGAGAACCAAGTGGGGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913706915_913706921 1 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706921 1:121434549-121434571 AGAGAACCAAGTGGGGTCTTGGG No data
913706916_913706921 -8 Left 913706916 1:121434534-121434556 CCACAGCAGAGGGACAGAGAACC No data
Right 913706921 1:121434549-121434571 AGAGAACCAAGTGGGGTCTTGGG No data
913706912_913706921 10 Left 913706912 1:121434516-121434538 CCTTAGGTACCAGCACAGCCACA 0: 20
1: 95
2: 164
3: 271
4: 391
Right 913706921 1:121434549-121434571 AGAGAACCAAGTGGGGTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913706921 Original CRISPR AGAGAACCAAGTGGGGTCTT GGG Intergenic
No off target data available for this crispr