ID: 913706923

View in Genome Browser
Species Human (GRCh38)
Location 1:121434564-121434586
Sequence GTCTTGGGATCCCCAATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913706915_913706923 16 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706923 1:121434564-121434586 GTCTTGGGATCCCCAATTCCAGG No data
913706912_913706923 25 Left 913706912 1:121434516-121434538 CCTTAGGTACCAGCACAGCCACA 0: 20
1: 95
2: 164
3: 271
4: 391
Right 913706923 1:121434564-121434586 GTCTTGGGATCCCCAATTCCAGG No data
913706916_913706923 7 Left 913706916 1:121434534-121434556 CCACAGCAGAGGGACAGAGAACC No data
Right 913706923 1:121434564-121434586 GTCTTGGGATCCCCAATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913706923 Original CRISPR GTCTTGGGATCCCCAATTCC AGG Intergenic
No off target data available for this crispr