ID: 913706924

View in Genome Browser
Species Human (GRCh38)
Location 1:121434570-121434592
Sequence GGATCCCCAATTCCAGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913706916_913706924 13 Left 913706916 1:121434534-121434556 CCACAGCAGAGGGACAGAGAACC No data
Right 913706924 1:121434570-121434592 GGATCCCCAATTCCAGGACTTGG No data
913706922_913706924 -8 Left 913706922 1:121434555-121434577 CCAAGTGGGGTCTTGGGATCCCC No data
Right 913706924 1:121434570-121434592 GGATCCCCAATTCCAGGACTTGG No data
913706915_913706924 22 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706924 1:121434570-121434592 GGATCCCCAATTCCAGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913706924 Original CRISPR GGATCCCCAATTCCAGGACT TGG Intergenic
No off target data available for this crispr