ID: 913706928

View in Genome Browser
Species Human (GRCh38)
Location 1:121434577-121434599
Sequence CAATTCCAGGACTTGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1180
Summary {0: 15, 1: 66, 2: 159, 3: 315, 4: 625}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913706922_913706928 -1 Left 913706922 1:121434555-121434577 CCAAGTGGGGTCTTGGGATCCCC No data
Right 913706928 1:121434577-121434599 CAATTCCAGGACTTGGCTCTTGG 0: 15
1: 66
2: 159
3: 315
4: 625
913706915_913706928 29 Left 913706915 1:121434525-121434547 CCAGCACAGCCACAGCAGAGGGA No data
Right 913706928 1:121434577-121434599 CAATTCCAGGACTTGGCTCTTGG 0: 15
1: 66
2: 159
3: 315
4: 625
913706916_913706928 20 Left 913706916 1:121434534-121434556 CCACAGCAGAGGGACAGAGAACC No data
Right 913706928 1:121434577-121434599 CAATTCCAGGACTTGGCTCTTGG 0: 15
1: 66
2: 159
3: 315
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913706928 Original CRISPR CAATTCCAGGACTTGGCTCT TGG Intergenic
900781572 1:4621746-4621768 GAATTCCAGGAATAGGCCCTTGG - Intergenic
901448444 1:9322117-9322139 CATTCCCAGGACTTAGCTCCTGG + Intronic
901581259 1:10245696-10245718 CACCTCCAGGCCTTGCCTCTTGG - Intronic
902120311 1:14159545-14159567 CAGTTCCAGAACTTGGCTTTTGG - Intergenic
902756114 1:18550259-18550281 GAATTCCTGGGCTTGGCTCTTGG + Intergenic
903128734 1:21264608-21264630 CAATTTCAGGAATTGGGGCTGGG - Intronic
903281299 1:22251431-22251453 CTATTCCAGGCCTTGGCCCGGGG - Intergenic
903374435 1:22856997-22857019 CTATCCCAGGACTTGGCACATGG - Intronic
905940694 1:41860964-41860986 CAAAGCCAGGACTAGGTTCTTGG + Intronic
906352967 1:45079557-45079579 TTATTCCAGGACTTGGCTCTTGG - Intronic
906695622 1:47821434-47821456 CAGCTACAGGACTTGGCTGTGGG + Intronic
906827048 1:48992920-48992942 GAATTCCAGGCCATGGCTCTAGG - Intronic
906906032 1:49893428-49893450 CAATTCTAGGCCTTGACTCTTGG + Intronic
907023779 1:51095087-51095109 TGATTTCAGGTCTTGGCTCTTGG + Intergenic
907440825 1:54476998-54477020 CTAGTCCAGGATTTGACTCTAGG - Intergenic
908024918 1:59940016-59940038 CAATTCCAGGCCTTGGCTCTTGG - Intergenic
908175566 1:61552283-61552305 TAATTCCAGGACTTGGCTCCTGG - Intergenic
908302283 1:62773982-62774004 TGATTCCAGGCCTTGGCTCGTGG - Intergenic
908396937 1:63733968-63733990 CAATTCCAGGAGATGGGTATAGG + Intergenic
908598978 1:65718744-65718766 AGATTGCAGGACTTGACTCTTGG - Intergenic
909084490 1:71155103-71155125 TGATTCCAGACCTTGGCTCTTGG - Intergenic
909271328 1:73627203-73627225 CAATTCTAGGTCTTGACTCTTGG + Intergenic
909309624 1:74129880-74129902 CTATTCCAGGACCTAGCTCTTGG - Intronic
909316272 1:74223571-74223593 TAATTCCAGGCCTTGGCTCTTGG + Intronic
909431304 1:75590507-75590529 CAATTCCAGGACTTGACTCTTGG + Intronic
909438644 1:75673158-75673180 TGATTCCAGGACTTGGATCCTGG + Intergenic
909667693 1:78153981-78154003 TGATTCCAGGACTTGACTCTTGG - Intergenic
910102472 1:83593680-83593702 TAATTCCAGGCGTTGGCTCCTGG - Intergenic
910379257 1:86608719-86608741 CAATTCTAGTACATGACTCTTGG - Intergenic
910547360 1:88433205-88433227 CAATTCCAGGACTTGCATCTTGG + Intergenic
910620566 1:89248880-89248902 CGATTCAAGGACATGGTTCTTGG + Intergenic
910724927 1:90328301-90328323 CATTTCCAGGCCTTGGCTCCTGG + Intergenic
910724978 1:90328610-90328632 CAACTCCAGGCCCTGGCTCCTGG + Intergenic
911241360 1:95470956-95470978 CAAGTCCAGGCTTAGGCTCTTGG - Intergenic
911373671 1:97024683-97024705 CGATTCCAGAACTTGGCTCTTGG + Intergenic
911496505 1:98637911-98637933 TGATTCCAGAACTTGACTCTTGG + Intergenic
911536428 1:99106000-99106022 TGATTCCAGGACTTGGCTCTTGG + Intergenic
911826079 1:102486406-102486428 TGATTCCAGGACTTGACACTTGG + Intergenic
911939093 1:104019290-104019312 TGATTCCAGGCCTTGGCTGTTGG - Intergenic
912036627 1:105324687-105324709 AGACTCCAGGACTTGACTCTTGG - Intergenic
912059017 1:105641442-105641464 AGATTCTAGGACTTGACTCTTGG + Intergenic
912280511 1:108308226-108308248 TGATTCCAAGACTTGACTCTTGG - Intergenic
912287715 1:108386131-108386153 TGATTCCAAGACTTGACTCTTGG + Intronic
912633239 1:111267447-111267469 CAATTCTAGGCCTTAGCTCTTGG - Intergenic
912853001 1:113143292-113143314 GAATTACAGCACTTGCCTCTGGG - Intergenic
912871545 1:113311343-113311365 CAATTCCAGGCCTTGGCTCTAGG + Intergenic
913706928 1:121434577-121434599 CAATTCCAGGACTTGGCTCTTGG + Intergenic
914848418 1:151295856-151295878 CAATCCCAGGACTGAGCTCTAGG + Intronic
915186007 1:154105740-154105762 CAATTTCAGGCCTTGGCTCCTGG + Intronic
917061688 1:171048585-171048607 GGATTCCAGGACTTGACTTTTGG - Intronic
917191383 1:172422691-172422713 TGATTCCAGTCCTTGGCTCTTGG + Intronic
917229840 1:172823846-172823868 CCATTCCAGGCCTTGGCCCATGG - Intergenic
917373077 1:174317082-174317104 TGATTCCAGAACTTGACTCTTGG - Intronic
918358015 1:183724371-183724393 CAGTTCCAAGCCCTGGCTCTTGG + Intronic
918915766 1:190634683-190634705 CAATTCCAGGCCTTGGCTCTTGG - Intergenic
919008484 1:191929412-191929434 CAACTCAAGGACTTGATTCTTGG + Intergenic
919067789 1:192714761-192714783 TGATTCCAGGACTTGGCCCTTGG + Intergenic
919147206 1:193651068-193651090 TAATTCCAGGCCTTGGCTCTTGG - Intergenic
919272076 1:195360653-195360675 CTATTCCATGACTTGACTCTTGG + Intergenic
919455855 1:197818771-197818793 CCATTCCAGGACTTAGCTCCTGG + Intergenic
919455909 1:197819118-197819140 CAGTTCCAGGCCTTGGCTCCTGG + Intergenic
919478065 1:198053941-198053963 CAAGTCCAGGCCTAGGCTCTTGG - Intergenic
919511534 1:198471839-198471861 TGATTCTAGGCCTTGGCTCTTGG + Intergenic
920549604 1:206847259-206847281 TGATTCTAGGACTTGGCTCTTGG + Intergenic
920594916 1:207259433-207259455 TATTTCCAGGCCTTGGCTCTTGG - Intergenic
920778658 1:208966493-208966515 CAAATCCAAGACTTTTCTCTTGG + Intergenic
921042615 1:211448328-211448350 TAATTCTAGGACTTGACTCTTGG + Intergenic
921296148 1:213705560-213705582 TGATTCCAGGACTTGGCTCTTGG - Intergenic
921746264 1:218743592-218743614 CAGTTTCAGGCCTTGGCTCCTGG + Intergenic
922377158 1:224980196-224980218 CGATTCCAAGCCTTGGTTCTTGG + Intronic
922388535 1:225113918-225113940 TGATTCCAGGCCTTGCCTCTTGG - Intronic
924770505 1:247075821-247075843 GAATTCTAGGACTTTGCTTTGGG - Intronic
924779059 1:247130333-247130355 GAATTCCAGGGCTTAGCTTTGGG + Intronic
924898845 1:248373047-248373069 CAATTCTCGGACTTGGCTCTTGG - Intergenic
1063588728 10:7376365-7376387 CATTTACAGGACTTGGGTGTCGG + Intronic
1064409824 10:15095617-15095639 CCATTACATTACTTGGCTCTGGG - Exonic
1064413884 10:15132119-15132141 TAATTCCAGGACTTTGGTCGGGG - Intronic
1064521685 10:16209572-16209594 CGAATCCAGGTCTAGGCTCTTGG - Intergenic
1064544812 10:16439471-16439493 CAGTGCCAGGACTTGGCCATAGG + Intronic
1064696788 10:17975201-17975223 AGATTCCAGGACTTGGCCCTTGG - Intronic
1064987496 10:21225822-21225844 CAATTCCAGGGCTTGGCTCTTGG - Intergenic
1065431439 10:25661199-25661221 CAATTCCAGGCCTTGACTCTTGG - Intergenic
1065467744 10:26043755-26043777 CCATTCCAGGTCTTGAGTCTGGG - Intronic
1066084522 10:31963316-31963338 TGATTCCAGAACTTGCCTCTTGG + Intergenic
1066527384 10:36296280-36296302 CAATTCTAGGCCTTGGCTCTTGG - Intergenic
1066981256 10:42418529-42418551 CCAATTCAGGCCTTGGCTCTTGG - Intergenic
1067163932 10:43849825-43849847 CAGTTCCTGGACATGGCCCTGGG - Intergenic
1067676575 10:48384777-48384799 CCATTCCTGGACTTGGCACCTGG - Intronic
1068029051 10:51684979-51685001 CAAGTCTAGTACTTGGTTCTTGG + Intronic
1068103936 10:52590895-52590917 TGATTCCAGGCCTTGGCTCTTGG - Intergenic
1068168472 10:53361483-53361505 AAACTCCAGGACTTTGGTCTGGG - Intergenic
1068392380 10:56414602-56414624 TGATTCCAGGCCTTGCCTCTTGG - Intergenic
1068478651 10:57562051-57562073 AAAATGTAGGACTTGGCTCTTGG - Intergenic
1068478756 10:57562748-57562770 TGATTCTAGGACTTGGGTCTTGG - Intergenic
1069060074 10:63885974-63885996 GAATTCTAGGACTAGGATCTGGG + Intergenic
1069193438 10:65519452-65519474 TGATTCCAGGCCTTGGCTCTTGG - Intergenic
1069435409 10:68377425-68377447 TAATTGCAGGTCTTTGCTCTTGG - Intronic
1069933564 10:71899997-71900019 CAATTCCAGGACTTGACTCTTGG - Intergenic
1070109519 10:73470478-73470500 CCATTCCACAACTTGTCTCTTGG - Intronic
1070156211 10:73837161-73837183 CATCTCCAGGGCTTGACTCTGGG - Intronic
1070606495 10:77902010-77902032 CAGTTTAGGGACTTGGCTCTGGG - Intronic
1071018082 10:81021431-81021453 TGATTCCAGGACTTGACTCTGGG + Intergenic
1071046682 10:81387509-81387531 CAGTTCCATGACTTGGCTCCTGG - Intergenic
1071197214 10:83175428-83175450 CAACTCCAGGACTTGACTCTTGG - Intergenic
1071209180 10:83317879-83317901 TAGTTCCAGGACTTGACTCTTGG + Intergenic
1071215254 10:83393587-83393609 CAGTTCCAGGATTTAGCTCCTGG - Intergenic
1071334888 10:84592554-84592576 CAATTCCAGGAATTGGCATGGGG - Intergenic
1071767824 10:88689185-88689207 CAATTCCAGGCCTTGGGTCTTGG + Intergenic
1071935500 10:90526190-90526212 CTGTTCCAGGACTTGAGTCTTGG - Intergenic
1071962995 10:90824582-90824604 TAATTCCAGGCCTTGGCTCTTGG + Intronic
1072058796 10:91788231-91788253 TGATTCCAGGCCTTGGTTCTTGG + Intergenic
1072862710 10:99023056-99023078 TGATTCCAGGACTTGACTCTTGG + Intronic
1073649353 10:105342160-105342182 GCATTCCAGGTCATGGCTCTGGG - Intergenic
1073678854 10:105680016-105680038 TGATTCTAGAACTTGGCTCTTGG + Intergenic
1073827093 10:107336641-107336663 CGATTCCAGGCCTAGCCTCTGGG - Intergenic
1073905482 10:108274686-108274708 CGATTCCAGGACTTGACTTTTGG - Intergenic
1074302145 10:112242414-112242436 CAATTCCAGGCTTTGGCTCCTGG - Intergenic
1074638097 10:115344569-115344591 CAATTTTAGGACTTAACTCTTGG - Intronic
1075031508 10:119027751-119027773 CAATGCCAGCACTAGGTTCTGGG + Intergenic
1075496405 10:122923010-122923032 CAGTTCTAGGGCTTGCCTCTTGG + Intergenic
1075665047 10:124223956-124223978 CATCTCCAGGCCCTGGCTCTCGG - Intergenic
1075689898 10:124387695-124387717 TAAGTCCAGGACTGGGCCCTGGG + Intergenic
1076170126 10:128312211-128312233 AAATTCGAGGACTTGTCACTTGG + Intergenic
1076463852 10:130665153-130665175 AAATTCCAGGCCCTGACTCTGGG + Intergenic
1076612025 10:131732125-131732147 CAGTTCCAGGGCTTGGCACCTGG - Intergenic
1076994833 11:292796-292818 CAATGCCAGGCCTTGCTTCTGGG + Intronic
1077427448 11:2489976-2489998 TGATTCCAGGCCTTGGCTCTTGG + Intronic
1077740427 11:4839881-4839903 CCATTCCAGGATTTGACTCTTGG + Intronic
1077970276 11:7181936-7181958 TGATTCTAGGACTTGACTCTTGG + Intergenic
1078690899 11:13579575-13579597 CAATTCCAGGTCTTGGCTCTTGG + Intergenic
1078843054 11:15096862-15096884 CAATTCTAGGCATTGGCTCCTGG - Intergenic
1078992599 11:16664900-16664922 CCATTCCAGGCCCTAGCTCTTGG + Intronic
1079069229 11:17328740-17328762 TGAGTCCAGGCCTTGGCTCTTGG - Intronic
1079183524 11:18215211-18215233 CAATTCCAGGACGTGGCTCTTGG + Intronic
1079363297 11:19787750-19787772 CAAATCTAGGACTTGGAGCTGGG + Intronic
1079530539 11:21447212-21447234 CAATTCCAGTCCTTGGCTCTGGG - Intronic
1079571887 11:21953235-21953257 TGATTCTAGGACTTGGCTTTTGG + Intergenic
1079625987 11:22618218-22618240 TGATTCTAGGACTTGACTCTTGG - Intergenic
1080128592 11:28766792-28766814 CTATTCCAGGTCTTGGCACTTGG + Intergenic
1080213663 11:29817034-29817056 CAATTCCAGGACTCAACTCCTGG - Intergenic
1080489820 11:32750749-32750771 CAATTCCAGGCATTGGCTCATGG - Intronic
1081073700 11:38642299-38642321 CAGTTGCAGGCCTTGGCTCTTGG - Intergenic
1081319122 11:41668835-41668857 CAGTTCCAGGCCTTTGCTCCTGG + Intergenic
1081416606 11:42822773-42822795 CAGAGCCAGGACTTGGCCCTGGG - Intergenic
1083512760 11:63227079-63227101 CAATTCTAGGTCTTAGCTCTTGG - Intronic
1084763832 11:71294612-71294634 CACTTGCAGGCCTTGGCTCTTGG - Intergenic
1085008168 11:73114371-73114393 TGATTCCAGGATTTGGCCCTTGG - Intronic
1085147332 11:74213043-74213065 CAATTCCAGGCCTTGGCTCTTGG + Intronic
1085147387 11:74213349-74213371 CAATTCCAAGCCCTGGCTCCTGG + Intronic
1085178464 11:74511327-74511349 TGATTCCAGGCCTTGGCTCTTGG + Intronic
1085194721 11:74662123-74662145 CAATTCCAGGCCTTGGCTCTTGG - Intronic
1085372286 11:76020271-76020293 TGATTCCAGGCCTTGGCTCTTGG - Intronic
1085477667 11:76798174-76798196 CAATCCCTGGGCTGGGCTCTGGG + Intergenic
1085572111 11:77568733-77568755 CAGTTCCAGGTCTTGGCTCATGG - Intronic
1085765773 11:79280419-79280441 CAGCTCCAGGGCCTGGCTCTGGG + Intronic
1086468178 11:87076475-87076497 CAAGTCCAGGTCTAGGCTCTTGG - Intronic
1086524707 11:87711597-87711619 CAATTCCAGAACTTGGCTCTTGG + Intergenic
1086569635 11:88266924-88266946 CAATTCCAGGACTTGGCTCCTGG + Intergenic
1087032003 11:93715425-93715447 CGATTCCAGGCCTTGGCTCTTGG - Intronic
1087178625 11:95120107-95120129 CGATTCTAGGACTTGGCTCTTGG - Intronic
1087299320 11:96413825-96413847 CAGTTCCTGGCCTTGGCTTTTGG + Intronic
1087377726 11:97366034-97366056 CGATTTCAGAACTTGACTCTTGG + Intergenic
1087380435 11:97398579-97398601 CGATTACAGCACTTAGCTCTTGG - Intergenic
1087417122 11:97871503-97871525 CAAATCCAGGCCTAGGCTCTTGG - Intergenic
1087492359 11:98844736-98844758 TGATTCCAGGTCTTGGCTCTTGG - Intergenic
1087532918 11:99406988-99407010 CGATTCTAGGACATGGCTATTGG - Intronic
1087691028 11:101320722-101320744 TGATTCCAGGATTTGGCTCTTGG - Intergenic
1088181840 11:107121595-107121617 CAGTTCCAGGTCTTGGCTCCTGG + Intergenic
1088361999 11:109001152-109001174 CAGTTCCAGGGTTTGGCTCTTGG - Intergenic
1088569944 11:111213288-111213310 CAATTTCAGGATTTGACTCTTGG + Intergenic
1088699728 11:112401012-112401034 CAAGTGCAGAACTTGGCTCCAGG - Intergenic
1088750339 11:112837400-112837422 CTTCTCCAGGACCTGGCTCTGGG - Intergenic
1090111221 11:123911341-123911363 CAAGTCCAGGCCTAGGCTCTTGG + Intergenic
1090318268 11:125817158-125817180 TGATTCCAGGACTTGGCTCATGG - Intergenic
1090676887 11:129007166-129007188 TGATTCTAGGCCTTGGCTCTTGG - Intronic
1090894229 11:130955249-130955271 CAATTCCTGTTCTGGGCTCTTGG + Intergenic
1091119080 11:133041939-133041961 AAATCCCAGGACCTGGCTCCAGG + Intronic
1092210549 12:6643573-6643595 TACTTCCAGGCCTTGGCTGTGGG + Exonic
1092670882 12:10859201-10859223 CAATTCCAGGCCCTGGCTCTTGG + Intronic
1092981088 12:13794965-13794987 CCATCCCAGGAGCTGGCTCTAGG - Intronic
1093124021 12:15306906-15306928 CACTTCCAGGATTTGACTCTTGG - Intronic
1093124557 12:15313081-15313103 CTATTCCAGGATTTGGCCCTTGG - Intronic
1093259495 12:16917823-16917845 CAATTCCAGGACTTGGTTCCTGG - Intergenic
1093403582 12:18777478-18777500 TAATTCCAGGATTTGGCTCATGG + Intergenic
1093420021 12:18964547-18964569 TAATTGTAGGCCTTGGCTCTTGG - Intergenic
1093617229 12:21241225-21241247 TGATTCCAGGACTTGACTCTGGG + Intergenic
1093991062 12:25590783-25590805 CCTTTCCAGGACTTAGCTCCAGG + Intronic
1093991114 12:25591128-25591150 AGATTTCAGGACATGGCTCTTGG + Intronic
1094018971 12:25894189-25894211 CACTTCCAAGAGGTGGCTCTGGG - Intergenic
1094258586 12:28464895-28464917 CAGTTCTAGGACTTGGCTCTTGG + Intronic
1094471529 12:30805936-30805958 CAAGTCCATGAATAGGCTCTGGG + Intergenic
1095133662 12:38572152-38572174 CAATTCTAGGACTTAACTCTTGG + Intergenic
1095163338 12:38941893-38941915 TGATTCCAGGCCTTGGCCCTTGG + Intergenic
1095227545 12:39695306-39695328 CAATTCCAGGACTTGGCTCTTGG + Intronic
1095573599 12:43709906-43709928 TGACTCCAAGACTTGGCTCTTGG - Intergenic
1096954860 12:55516100-55516122 TGATTCCAGAACTTGACTCTTGG + Intergenic
1097146990 12:56948555-56948577 TGATTCCAGGACTTGACTCTTGG - Intergenic
1097426027 12:59445835-59445857 CAATGTCAGGTCTTGACTCTTGG - Intergenic
1097473223 12:60021581-60021603 CAGTTTCAGGACTTGACTCTTGG - Intergenic
1097558990 12:61177584-61177606 CAAATCCAGAAGTTGGTTCTTGG - Intergenic
1097563623 12:61239691-61239713 CAATTCCAGGACTTGACTCTTGG - Intergenic
1097769932 12:63572127-63572149 CGATTCCAGGCCTTGGCTCTTGG + Intronic
1097791355 12:63818512-63818534 CAATTCTAGGACTTGACCCTTGG + Intergenic
1098207899 12:68132534-68132556 CCATTCCAAGACTTGGCTCTTGG - Intergenic
1098333907 12:69382325-69382347 CAACTCCAGGCCCTGGCTCCTGG - Intronic
1098333968 12:69382634-69382656 CAATTCCACGCCTTGGCCCTTGG - Intronic
1098492014 12:71092959-71092981 TGATTCCAGGACTTGGCTCTTGG - Intronic
1098705612 12:73685191-73685213 CAATTCCAGGACTTGAATCTTGG + Intergenic
1098869206 12:75797944-75797966 TAATGCCAAGACTTGTCTCTGGG + Intergenic
1099433798 12:82619777-82619799 CAATTCCAGGACTTGACTGTTGG + Intergenic
1099495328 12:83339731-83339753 CAGTTCCAGGACTTGACTCTTGG + Intergenic
1099524791 12:83705913-83705935 CGATTCCAGGACTTGACATTTGG + Intergenic
1099548488 12:84013776-84013798 CTATTCCAGGACCTAGCTCATGG - Intergenic
1099764148 12:86960766-86960788 CAAGTCCAGGCCTAGGTTCTTGG - Intergenic
1100061003 12:90575587-90575609 CAATTCCAGGCATTGGCTCTTGG - Intergenic
1100360781 12:93877788-93877810 CAACTCCAGGACTTGACTCTTGG - Intronic
1101162613 12:101994290-101994312 CACTTCTAAGACTTGGCTCTTGG - Intronic
1101226685 12:102694592-102694614 CAATCCCAGCATTTGGCTCTTGG + Intergenic
1101251967 12:102945736-102945758 CAATTCCAGGCCTTGGCTCTTGG - Intronic
1101607500 12:106258737-106258759 CAAGTCCAGGCCTTGGCTCTTGG + Intronic
1102301599 12:111775428-111775450 ACAAGCCAGGACTTGGCTCTTGG + Intronic
1103244900 12:119448338-119448360 CAATGCCAGGATTTGGATTTCGG - Intronic
1103727365 12:123004805-123004827 AAATTTCAGGAGTTTGCTCTTGG - Intronic
1103878713 12:124149416-124149438 CAGGTCCAGCACTTGGCTTTGGG + Intronic
1105460345 13:20579587-20579609 TGATTCCAGGCCTTGGCTCTTGG - Intronic
1106074795 13:26448775-26448797 CATTTCTAGGCCTTGGCTCCTGG + Intergenic
1106896006 13:34302921-34302943 TGATTCCAGGCCTTGGTTCTTGG + Intergenic
1106964057 13:35038305-35038327 CAATTCTAGGACTTGACTATTGG - Intronic
1107083944 13:36405552-36405574 CAATTCCAGGACTTGATTCTTGG - Intergenic
1107178124 13:37423302-37423324 TGATTCTAGGACTTGGCTCTTGG + Intergenic
1107552191 13:41487533-41487555 CTATTCCAGGACTTGGCTGTTGG - Intergenic
1107582206 13:41802692-41802714 CAATTCCAGGACTTAGCTCCTGG + Intronic
1107774398 13:43822882-43822904 CGGTTCCAGGCCTAGGCTCTTGG - Intergenic
1107807857 13:44171853-44171875 TGATTCCAGGACTTGGTTCTTGG - Intergenic
1108099264 13:46936618-46936640 CAATTCCAGGCCTTGACTCTAGG + Intergenic
1108229794 13:48324628-48324650 TAATTCCATGTCTTGGCTGTTGG + Intronic
1108259863 13:48645803-48645825 GAATCCCAGGACCTGGCTGTTGG + Intergenic
1108677110 13:52746586-52746608 CCATTCCAGGACTTTGTTCCAGG - Intergenic
1108858053 13:54820121-54820143 TGATTCCAGGCCTTGGCTCTTGG + Intergenic
1108962133 13:56247378-56247400 CAAATCCAGGTCTAGGCTCTAGG - Intergenic
1108962176 13:56247683-56247705 CTATTCCAGGACCTAGCACTTGG - Intergenic
1108973254 13:56403047-56403069 TGATTCCAGGACTTGGCTCTTGG + Intergenic
1109016491 13:57021409-57021431 CAATTCCAGGACTTGACTCTTGG + Intergenic
1109100690 13:58180799-58180821 CCATTCCAGGCCTTGGCTCTTGG - Intergenic
1109336673 13:61003414-61003436 CTATTCCAGGCCTTGGCTCTTGG - Intergenic
1109685851 13:65818988-65819010 CAACTCTAGGCCTTGGCTCTTGG + Intergenic
1109961633 13:69639145-69639167 CTATTCAAGGCCTTGGCTCTTGG - Intergenic
1110078920 13:71286610-71286632 CAGTTCCAGGCATTGACTCTTGG - Intergenic
1110376744 13:74802776-74802798 GGATTCCAGGCCTTGGCTCTTGG + Intergenic
1110501316 13:76231547-76231569 AAATTCTAGGACTTGGCCCTTGG + Intergenic
1110665755 13:78115910-78115932 CTATTCCAGGCCATTGCTCTTGG - Intergenic
1110915160 13:81012115-81012137 GAATTCAAGGCCTTGGCTCTTGG - Intergenic
1111085803 13:83373802-83373824 CGATTCCAGAACTTGGCTTCTGG - Intergenic
1111291954 13:86182783-86182805 CATTTCCAGGCCTTGGCCCTTGG + Intergenic
1112400454 13:99073007-99073029 GAATTCCAGGAATTGGCCATAGG + Intronic
1112618863 13:101034621-101034643 TTATTCCAGAACTTGACTCTTGG - Intergenic
1112901479 13:104362990-104363012 TAATTCCAGGACTTGGCTTTTGG - Intergenic
1114072654 14:19126949-19126971 CAATTCTAGGACTTGACTCTTGG - Intergenic
1114089603 14:19273023-19273045 CAATTCTAGGACTTGACTCTTGG + Intergenic
1114245069 14:20905365-20905387 CAGTTCCAGATCTTGGCTTTTGG + Intergenic
1114248080 14:20933537-20933559 CAATTCCAGATCTTGGCTCTTGG + Intergenic
1114250909 14:20959617-20959639 CAATTCCAGATCTTGGCTCGTGG + Intergenic
1114432218 14:22671281-22671303 CAGTTCTAGGACTTGGCTCTTGG + Intergenic
1115133925 14:30086535-30086557 CAAGTCCAGGCCTAGGATCTTGG + Intronic
1115661025 14:35494474-35494496 CAATTCCAGGACTTGGCTCTTGG + Intergenic
1115724224 14:36195089-36195111 CAATTCCAGGATTTGTATATAGG + Intergenic
1115821012 14:37212282-37212304 TGATTCCAGAACTTGACTCTTGG + Intronic
1115948662 14:38694734-38694756 CGATTCCAAGTCTTGGCTCTTGG + Intergenic
1116079415 14:40154450-40154472 TAATTCCAGGTAATGGCTCTTGG + Intergenic
1116087030 14:40253739-40253761 CAATTCTAGGCCTTGGTTCTTGG - Intergenic
1116192597 14:41679818-41679840 TGATTCCAGGCCTTGGGTCTTGG + Intronic
1116220882 14:42085682-42085704 CAGTTCAAGAACTTGGCTCTTGG - Intergenic
1116247000 14:42428107-42428129 AAGTTCCAGGACTTTGGTCTGGG + Intergenic
1116351708 14:43871569-43871591 CAATTCCAGAACTTGACCCTTGG - Intergenic
1116413271 14:44650137-44650159 CAACTCCAGGCCCTGGCTCCTGG + Intergenic
1116481084 14:45392204-45392226 TGATTCCAGGACTTGGCTATTGG + Intergenic
1116497727 14:45582870-45582892 CAATCCCAGGCCCTGGCTCCTGG - Intergenic
1116504827 14:45665322-45665344 TGATTCCAGGACTTGACGCTTGG - Intergenic
1116765966 14:49070768-49070790 CAGGTCCAGGCCTAGGCTCTTGG + Intergenic
1117110388 14:52447114-52447136 CAATTCTAGGCCTTGGCTCTTGG + Intronic
1117161419 14:52994127-52994149 CAATTCAAGGCCTTGGCTACTGG - Intergenic
1117418377 14:55519143-55519165 CAAGTCCTGGCCTAGGCTCTTGG + Intergenic
1117483106 14:56168610-56168632 TGATTCTAGGACTTGACTCTTGG - Intronic
1117504420 14:56388300-56388322 CAACTCCAGGCCTTGGTTCTGGG - Intergenic
1117606216 14:57431447-57431469 CAATTCCAGGCCTAGGCTCTTGG + Intergenic
1117606973 14:57440105-57440127 CAGTTCTAGGCCTTGACTCTTGG - Intergenic
1117795354 14:59388203-59388225 CAACTTCAGGCCCTGGCTCTGGG - Intergenic
1117795404 14:59388503-59388525 CAATTCTAGCCCTTAGCTCTTGG - Intergenic
1118084392 14:62398629-62398651 TGATTCCAGGCCTTAGCTCTTGG - Intergenic
1119346425 14:73928554-73928576 CAATTCCAAGACTTGTGCCTAGG - Intronic
1120100135 14:80435331-80435353 CAGTTCTAGGCCTTGGCTCCTGG + Intergenic
1120439648 14:84520353-84520375 CAGTTCTAGGCCTTGGCTCCTGG - Intergenic
1121021274 14:90581602-90581624 CATCTCCAGGACTGGGATCTTGG - Intronic
1122931719 14:104936168-104936190 CTATCCCAGGCCTTGACTCTTGG + Exonic
1123502575 15:20903290-20903312 TTATTCCAGGTCTTGGCACTTGG + Intergenic
1123559824 15:21476957-21476979 TTATTCCAGGTCTTGGCACTTGG + Intergenic
1123596060 15:21914256-21914278 TTATTCCAGGTCTTGGCACTTGG + Intergenic
1124454598 15:29829053-29829075 CAATTCTAAGTCTTGGCTCTTGG + Intronic
1124844259 15:33275263-33275285 CAGTTCTAGGACTCGGCTCTTGG - Intergenic
1124857039 15:33399116-33399138 TAATGCCAGGATTTGGCCCTAGG - Intronic
1125272302 15:37952765-37952787 CAATTTCAGGACTTGGCTCTTGG + Intronic
1125276982 15:38003836-38003858 TGATTCCAGGCCTTGGCTCCTGG - Intergenic
1125444499 15:39738829-39738851 CACTGCCAGGACTGGCCTCTGGG - Intronic
1126015688 15:44348253-44348275 TAATTCCAGGCCTTAGCTCCTGG + Intronic
1126250766 15:46565607-46565629 CAATTCCAGGACTTGGCTCTTGG - Intergenic
1126285779 15:47009153-47009175 TGATTCCAGGATTTGGCTCCTGG - Intergenic
1126294963 15:47129651-47129673 CGATTCTAGGAGTTGACTCTTGG - Intergenic
1126486569 15:49187875-49187897 CAATTCTAGGACTTGGCTCCTGG - Intronic
1126489078 15:49216318-49216340 CAATTCCAGGACTTAGTTCCTGG - Intronic
1126503884 15:49380318-49380340 CAGTTCCAGGATTTGACTCTTGG - Intronic
1126517608 15:49553836-49553858 CAATTCCAGGACTTGACTCTTGG - Intronic
1126660702 15:51030622-51030644 CAATTCCAGGCCTTGGCTTCTGG - Intergenic
1127035211 15:54908511-54908533 TGATTCCAGGACTTGATTCTTGG + Intergenic
1127493242 15:59484827-59484849 TGACTCCAGGCCTTGGCTCTTGG + Intronic
1128364497 15:66988214-66988236 AAATTCCAGGCCTCAGCTCTTGG + Intergenic
1129501075 15:76038317-76038339 TGATTCCAGGCCTTGGCTCGTGG + Intronic
1129561773 15:76577910-76577932 TGATTCCAGGCCTTGGCTCTTGG + Intronic
1129642466 15:77394143-77394165 CAACTCCAGGCCCTGGCTCCTGG + Intronic
1129898708 15:79129076-79129098 TGATTCCAGGACCTGCCTCTGGG - Intergenic
1130400327 15:83546468-83546490 CAGTTCCAGGCCTTAGCTCCTGG - Intronic
1130700872 15:86179151-86179173 CAATTCCAGGAACTGGCCTTAGG - Intronic
1131315089 15:91328895-91328917 CAGTTCCAGGCCTTGGTTCCTGG - Intergenic
1131959408 15:97773089-97773111 CAATTCCAGGACTTGTCTCTTGG - Intergenic
1132081503 15:98869814-98869836 CAATTCAAGGGCTTTGCTTTTGG + Intronic
1132439098 15:101841265-101841287 CAGTTCCAGGCCTTGGCTCTGGG - Intergenic
1202968167 15_KI270727v1_random:204119-204141 TTATTCCAGGTCTTGGCACTTGG + Intergenic
1133895128 16:9919847-9919869 CAGTTCCAGGTCTTTGCCCTTGG + Intronic
1134407022 16:13969737-13969759 TGATTCCAGGCGTTGGCTCTTGG - Intergenic
1135144362 16:19948792-19948814 AAATTCCAGGAACTGGCTCTAGG + Intergenic
1135145566 16:19959852-19959874 AAATTCCAGGAACTGGCTCTAGG + Intergenic
1135658836 16:24277029-24277051 CAGTGCCAGGGCTTGGTTCTTGG + Intronic
1138638280 16:58361718-58361740 TGATTCCAGGACTTGGCTCTTGG - Intronic
1138738104 16:59276153-59276175 CAAATCCAGGACTTGGGTCATGG + Intergenic
1138916572 16:61471758-61471780 CAATTCCAGAACTTGCTTCTTGG + Intergenic
1139373606 16:66483384-66483406 CAACTTCAGGACCTGACTCTAGG + Intronic
1140449184 16:75056596-75056618 CATTTCAAGGACTTGGTTCATGG + Intronic
1140972471 16:80027069-80027091 AGATTCCAGGACTTGTCTTTGGG + Intergenic
1141010878 16:80397354-80397376 CAGTTCCAGGACGTCGCTTTTGG + Intergenic
1141203985 16:81919199-81919221 CAACTACAGGACTTGACTTTAGG - Intronic
1142919265 17:3170185-3170207 TGATTCCAGTTCTTGGCTCTTGG + Intergenic
1143420386 17:6786689-6786711 CATTTCCACGACCTGGCTCTGGG - Intronic
1143998182 17:11027223-11027245 CAATGCCAGGACTTGTCTCTGGG + Intergenic
1144685382 17:17222736-17222758 CAACTCCAGGACCTGACTCCTGG + Intronic
1145069201 17:19788672-19788694 CAAGTCTAGGCCTAGGCTCTTGG + Intronic
1146242529 17:31243751-31243773 AGATTCCAGGCCTTGGCTCCTGG - Intronic
1147149901 17:38508704-38508726 AGAATCCAGGACTTGGCTGTGGG + Intronic
1147500199 17:40955760-40955782 CAATTGCTGGAATTGGCTCTGGG + Intergenic
1149111241 17:53033359-53033381 CAATTCTAGGCCCTGGCTTTTGG - Intergenic
1149157338 17:53647691-53647713 TGATTCTAGGACTTGACTCTTGG - Intergenic
1149231289 17:54537167-54537189 TGATTCCAGGACTAGGCTCTTGG + Intergenic
1149611818 17:57962981-57963003 GAATTCCAGGAGTTGGCACATGG - Intergenic
1150192563 17:63258774-63258796 CAATTCCAGGCCTTGGCTCCTGG - Intronic
1150541517 17:66104686-66104708 CAATTCCAGGCCTTGGGTCCTGG + Intronic
1150594134 17:66589578-66589600 CAATTCCAGGTCTTAGATTTTGG - Intronic
1152130975 17:78476287-78476309 TAATTCCGGCACTTGGCTGTGGG - Intronic
1152920243 17:83062892-83062914 AACTCCCAGGACCTGGCTCTGGG + Intergenic
1153075299 18:1155926-1155948 CAATTCCAGGACTTGACTCTTGG - Intergenic
1153453854 18:5259524-5259546 AAATTCCAGGACTTGGTTCTTGG + Intergenic
1153715030 18:7839123-7839145 TGGTTCCAGGACTTGACTCTTGG - Intronic
1154230666 18:12553283-12553305 CAGTAAGAGGACTTGGCTCTAGG + Intronic
1154407492 18:14107634-14107656 TTATTCCAGGCCTTGGCACTTGG + Intronic
1154491141 18:14923214-14923236 TGATTTCAGGCCTTGGCTCTTGG + Intergenic
1154930933 18:20995496-20995518 CAATTCCAGGTCCTGGTTCTTGG + Intronic
1155443482 18:25885557-25885579 CAACTCCAGGCCCTGGCTCCTGG + Intergenic
1155533810 18:26795052-26795074 TGATTCCAGGACTTGGCTCTTGG + Intergenic
1155597299 18:27502696-27502718 CAATGCCACGAGTTGGCACTTGG + Intergenic
1156055611 18:32999042-32999064 CAATTCCAGGCTGTGGCACTTGG + Intronic
1156094271 18:33510478-33510500 CAGTTCCATGCCTTGGCTCTCGG + Intergenic
1156912363 18:42425947-42425969 CAATTCCAGGACTAGGCTCTTGG - Intergenic
1157065241 18:44341911-44341933 TGATTCTAGGCCTTGGCTCTTGG - Intergenic
1157326482 18:46672562-46672584 CACTTCCATGACTTAGCTGTTGG - Intronic
1157701996 18:49767277-49767299 CTGGTCCAGGGCTTGGCTCTGGG + Intergenic
1157879322 18:51305025-51305047 CAGTTCCAGGCCTTGTCTCTTGG + Intergenic
1157879380 18:51305334-51305356 CAACTCCAGGCCTGGGCTCCTGG + Intergenic
1158325407 18:56308422-56308444 TCATTCCTGGACTTGGATCTAGG - Intergenic
1158431293 18:57389793-57389815 CAATTCCAGAACTTGGCTCTTGG + Intergenic
1158432808 18:57405265-57405287 CAGTTCCTGGTCTTGGCTCAGGG - Intergenic
1158481269 18:57823862-57823884 CAATTCCAGGCCGTGGCTCTTGG - Intergenic
1159080591 18:63731288-63731310 CCGTTCCAGGACCTGGCTCCTGG + Intergenic
1159339666 18:67118938-67118960 TGATTCCAGGCTTTGGCTCTTGG - Intergenic
1159775320 18:72597980-72598002 CAATTCCCGGCCTTGGCTCCTGG - Intronic
1159972795 18:74674644-74674666 CTACCCCAGGGCTTGGCTCTGGG + Intronic
1160138389 18:76295744-76295766 TAATTCCAGGCTGTGGCTCTTGG - Intergenic
1160250296 18:77197546-77197568 CAAAACCAGGAATTCGCTCTTGG + Intergenic
1160371427 18:78375334-78375356 CAAATCCATGTCTGGGCTCTGGG + Intergenic
1161735151 19:5987645-5987667 CACTTCCACGACCTGGCTCATGG - Intergenic
1162346787 19:10123420-10123442 TAATCCCAGCACTTGGCTCATGG - Intergenic
1162693011 19:12449401-12449423 TGATTCCAGGCCTTGGATCTTGG - Intronic
1163302871 19:16458610-16458632 CACTTTCAGGACTGGGCTCAGGG - Intronic
1165796656 19:38523765-38523787 CATTTCCAGGCCTTGGCTCGGGG - Intronic
1165886549 19:39083372-39083394 CAATTTCAGAAATTGGCACTAGG - Intergenic
1165964369 19:39563158-39563180 TAATTCAGGGACTTGGTTCTTGG - Intergenic
1166756073 19:45192358-45192380 TGATTCCAGGCCTTGGCTCTTGG - Intronic
1166930369 19:46298236-46298258 CTATTCCAGGCCCTGGCTCTGGG + Intronic
1167083146 19:47290973-47290995 CGATTCCAGGCCATGGCTCTTGG + Intronic
1168605732 19:57758741-57758763 TAATTTCAGGCCTTGGCTCTTGG + Intergenic
1168615416 19:57833470-57833492 TGATTCCAGGCCTTGGCTCGTGG - Intronic
1168621368 19:57881977-57881999 TGATTCCAGGCCTTGGCTCGTGG + Intronic
925249660 2:2421623-2421645 CGATTCCAGGACTTGGCTCTTGG - Intergenic
925269451 2:2591896-2591918 CCATTCCAGGACTTGGCTCTTGG + Intergenic
925698926 2:6613504-6613526 CAATTCCAAGTCTTGGCTTCTGG - Intergenic
925698987 2:6613858-6613880 CTATTCCAGGCCTTGGCCCCTGG - Intergenic
925879460 2:8340179-8340201 CAGTTCCAAGACTTGCCTTTAGG + Intergenic
925905803 2:8539128-8539150 GAATTCCAGGGCTGGGCACTTGG - Intergenic
926478366 2:13356963-13356985 CAATTCCAGGATATAGCTCTTGG + Intergenic
926600927 2:14844608-14844630 CAATTCCAAGCCTTGGGTCCTGG + Intergenic
926834135 2:16999001-16999023 CAATTCCAGGCCGTGGCTCTTGG - Intergenic
927760019 2:25744249-25744271 CCATTCCAGGACCTGGCCCAGGG - Exonic
928077427 2:28277950-28277972 CACTTCCAAGACTGAGCTCTAGG - Intronic
928293555 2:30061313-30061335 CAGTTTCAGGTCTTGGCTCTTGG + Intergenic
928318675 2:30266268-30266290 CAAGGCCAGGATTAGGCTCTGGG + Intronic
928458898 2:31451052-31451074 CAATTCCAGGACCTAGGACTTGG + Intergenic
928484124 2:31712149-31712171 TGATTCCAGGTCTTGGCTCCTGG + Intergenic
928715520 2:34055835-34055857 CAGTTCTAGGCCTTGGCTCTTGG - Intergenic
928802929 2:35115887-35115909 CATTTGCAGGCATTGGCTCTGGG + Intergenic
928863947 2:35895450-35895472 CAATTCCAGACCTTGGCTATTGG - Intergenic
929215146 2:39404285-39404307 TGATTCTAGGCCTTGGCTCTTGG + Intronic
929281715 2:40087361-40087383 CAATTTCAGGCATTGGCTCTTGG - Intergenic
929410672 2:41694959-41694981 CACTTACAGGGCTTGGCACTGGG + Intergenic
929926545 2:46217008-46217030 TGATTCCAAGACTTGACTCTCGG - Intergenic
930041501 2:47128725-47128747 CAATTCCAGGCATTGGCTCCTGG - Intronic
930263734 2:49176217-49176239 GATTTTCAGGTCTTGGCTCTTGG + Intergenic
930288837 2:49467912-49467934 CAATTCCAGGTCTTGGGTCTTGG - Intergenic
930527069 2:52543193-52543215 CGATTCCAGGACTTGGATCTTGG + Intergenic
930778279 2:55196903-55196925 CAATTCCAGCACTTCGTTCTTGG + Intronic
930899960 2:56494129-56494151 CAAATCCAGGAGTTGGTTTTTGG - Intergenic
930944873 2:57061499-57061521 TGATTCCAGGCCTAGGCTCTTGG - Intergenic
930972132 2:57408707-57408729 CGATTCTAAGACTTGACTCTTGG + Intergenic
931012157 2:57929496-57929518 TGATTCCAGGCCTTGGTTCTTGG - Intronic
931085947 2:58830858-58830880 CAATTCCAGGCCTTTGCTCTTGG - Intergenic
931161923 2:59702292-59702314 TGATTCCAGAACTTGACTCTTGG - Intergenic
931572280 2:63681248-63681270 CAGTTCCAGGACTTGTCTCTTGG + Intronic
931600834 2:64001309-64001331 TGATTCCAGGCCTTGGCTCTTGG - Intronic
931637280 2:64351999-64352021 CGATTCTAGAACTTGGCTCTTGG + Intergenic
932858769 2:75266830-75266852 CAATTCCAGGACTTGTCTCTTGG - Intergenic
933162876 2:79045237-79045259 TGATTCCAGAACTTGGCTCTTGG + Intergenic
933339443 2:81004010-81004032 CATTTCTAGGACTTGGCTCTTGG - Intergenic
933348947 2:81128055-81128077 TGATTCCAGGTGTTGGCTCTTGG - Intergenic
935078608 2:99770422-99770444 TGATTCCAGGCCTTGGCTGTTGG - Intronic
935632307 2:105222200-105222222 CCATTCTAGGAATTGGTTCTAGG - Intergenic
935928230 2:108093558-108093580 CAATTTCAGGACCTGACTCTTGG - Intergenic
936511270 2:113149524-113149546 TGATTCCAGGCCTTGGCACTTGG - Intergenic
936825423 2:116576358-116576380 TAATTCCAGGACTTAAATCTTGG - Intergenic
936831560 2:116654007-116654029 TGATTCCAGGACTTGGCTCCTGG + Intergenic
936925361 2:117731149-117731171 TGATTCCAGGTCTTGGCTCTTGG + Intergenic
936973403 2:118196033-118196055 CAAGTCCAGGATTTGTTTCTGGG - Intergenic
937077455 2:119117539-119117561 CAATTTCAGCAGTGGGCTCTGGG - Intergenic
937560585 2:123219194-123219216 CAATTCCAGGCCTTGACTCTTGG + Intergenic
937628346 2:124069046-124069068 CAAGTCCAGGCCTAGGCTCTTGG + Intronic
938177918 2:129153151-129153173 CAAGTCCAGGCTTAGGCTCTGGG - Intergenic
938486892 2:131720419-131720441 CAATTCTAGGACTTGACTCTTGG - Intergenic
938619282 2:133032176-133032198 CAGTTTTAGGACTTGACTCTTGG + Intronic
939244797 2:139609781-139609803 CAGTCCCAGGAATTGACTCTTGG - Intergenic
939257220 2:139759659-139759681 TAATTTCAGGACTTCACTCTTGG - Intergenic
939405054 2:141745619-141745641 CAGTTCCAGGCCTTGACTCTTGG - Intronic
939443187 2:142275867-142275889 TGATTCCAGGACTTGACTCTTGG - Intergenic
940402324 2:153261999-153262021 CAATTCTAGGCCTTGACTCTTGG - Intergenic
940468683 2:154064938-154064960 CAATTCTAGGCTTTGGCTCTTGG + Intronic
940560356 2:155287863-155287885 TGATTCCAGGATTTGGCTCTTGG + Intergenic
940738501 2:157480398-157480420 CAATTCCAGGACTTGGCTCTTGG + Intronic
940947758 2:159637249-159637271 TAAGTCCAGGCCTAGGCTCTTGG + Intergenic
941227682 2:162868751-162868773 TAATTCCAGGACTTGACTCTTGG + Intergenic
941528237 2:166632182-166632204 CAATTCCAGCCCTTGGTTCTTGG - Intergenic
941672565 2:168310551-168310573 CGAGTCCAGGCCTAGGCTCTTGG - Intergenic
941851794 2:170190788-170190810 CAGTTCTAGGCCTTGGCTCTTGG - Intronic
942153956 2:173107497-173107519 ATACTCCAGGACTAGGCTCTGGG - Intronic
942294935 2:174508016-174508038 TGATTCTAGGCCTTGGCTCTTGG + Intergenic
942352341 2:175065634-175065656 CAATTCCAGGACGTGGCTCTTGG + Intergenic
942409810 2:175697245-175697267 AAATTCCAAGAGTGGGCTCTGGG - Intergenic
942734696 2:179096740-179096762 CAGTTCTAGGACTTAGGTCTTGG - Intergenic
942769107 2:179495069-179495091 CAGATCCAGGACTGGACTCTTGG + Intronic
942915018 2:181294720-181294742 TGATTCCAGGTCTTGACTCTTGG + Intergenic
942972248 2:181971010-181971032 TGATTCCAGGCCTTGGCTCCTGG - Intronic
942972299 2:181971361-181971383 CCATTCCAGGACCTAGCTCCTGG - Intronic
943067603 2:183105375-183105397 TGATTCCAGGCCTTGGCTCCTGG - Intergenic
943099518 2:183471357-183471379 TGATTCCAGGCCTTGGCTCCTGG - Intergenic
943118939 2:183710177-183710199 CACTTTCAGGACTTTACTCTTGG - Intergenic
943226766 2:185187965-185187987 CAATTCCAGGACTTGACTCTTGG - Intergenic
943309728 2:186310813-186310835 CAGTTCTAGGACTTGATTCTTGG + Intergenic
943484701 2:188464947-188464969 TGATTCTAGGACTTGACTCTTGG - Intronic
943845131 2:192635420-192635442 TGATTCCAGGATTTGGCTCTTGG + Intergenic
944046181 2:195414291-195414313 CAACTCCAGGTCTTGACTCTTGG + Intergenic
944078616 2:195759603-195759625 CAATTCCAGGCCTTGGCTCCTGG + Intronic
944550410 2:200839937-200839959 CAATTCCAGGCCTTAGCTCTTGG + Intergenic
944616386 2:201465033-201465055 TGATTCCAGGCCTTGGCTCCTGG - Intronic
944678972 2:202059210-202059232 CGACTCCAGGACTTTGGTCTGGG + Intergenic
944963357 2:204901531-204901553 TGATTCCAGGCCTTGGCACTTGG - Intronic
945210246 2:207375289-207375311 TTGTTCCAGGATTTGGCTCTTGG + Intergenic
945575665 2:211525651-211525673 CAATTTTAGGCCTTGGTTCTTGG + Intronic
945739745 2:213645291-213645313 TAATTCCAGGACCTGACTCTTGG - Intronic
946984719 2:225258447-225258469 TGATTCCAGGACTTGACTCTTGG + Intergenic
947130894 2:226923944-226923966 TGATTCCAGGCCTTGGCTCTTGG - Intronic
1168899906 20:1354690-1354712 CGATTCCAGGTCTTGGCTCCTGG - Intronic
1169479606 20:5966941-5966963 CTATTCCATGACTTGTCTTTCGG + Intronic
1169628337 20:7597639-7597661 CAATTCCAGGACTTGGCTTTTGG + Intergenic
1169988759 20:11475088-11475110 TAATTCCAGGCCTTGGCTCCTGG + Intergenic
1170086936 20:12544394-12544416 CTATTCCAGGACTTGACTCTTGG - Intergenic
1170864146 20:20138047-20138069 CTATTCCAGGCCCTGGCTCCTGG - Intronic
1171031065 20:21676749-21676771 CAGTTCCAGGAAATGGCTCTTGG - Intergenic
1171415813 20:24979741-24979763 TGCTGCCAGGACTTGGCTCTAGG - Intronic
1171937987 20:31294028-31294050 AGATTCTAGAACTTGGCTCTTGG + Intergenic
1172419010 20:34797974-34797996 CAATTCCAGGCCTTGGTTCTTGG + Intronic
1172770639 20:37380500-37380522 CAATTCAAGGTCTGAGCTCTGGG + Intronic
1173004143 20:39126843-39126865 CGATTCCAAGACTTGGCTCTTGG - Intergenic
1173098941 20:40065551-40065573 CAATTCCAGAATTTGGCTCTTGG + Intergenic
1173582533 20:44157765-44157787 CAAGGCCAGGATTTGGCCCTAGG + Intronic
1174831849 20:53820552-53820574 TGATTCCAGGTCTTGGCTCTTGG - Intergenic
1174938558 20:54898569-54898591 TGCTTCCAGGCCTTGGCTCTTGG + Intergenic
1175640363 20:60624441-60624463 CAAATTCAGGGCTAGGCTCTGGG - Intergenic
1176876639 21:14136274-14136296 CAATTCCAGGACTTGATTCTTGG + Intronic
1176899347 21:14420526-14420548 CTATTCCAGGACTTGCCTCTTGG + Intergenic
1177222219 21:18209463-18209485 CAGTTCTAGGCCTTGGCTCTGGG - Intronic
1177592246 21:23185550-23185572 TGATTCCAGGCCTTGGCTCCTGG + Intergenic
1177771327 21:25519424-25519446 TAATTCCAGGCCTTGGCTCTTGG + Intergenic
1178007252 21:28235227-28235249 TGATTCCAGGACTTGATTCTTGG + Intergenic
1180491100 22:15849324-15849346 CAATTCTAGGACTTGACTCTTGG - Intergenic
1181553274 22:23653048-23653070 CACTTCCAGGACTCAGCTCCTGG - Intergenic
1181716889 22:24737652-24737674 CAATCCCAGGCCTTGGCTCGTGG + Intronic
1184046938 22:41977592-41977614 CAGTTCCAGCCCTAGGCTCTGGG - Intronic
1184313214 22:43662271-43662293 CAATGCAGGGACTTGGATCTGGG + Intronic
1184862547 22:47182087-47182109 CAGTTCTAGGACTTGACTCTTGG + Intergenic
949592916 3:5512300-5512322 CAATTTCAGAACTTGTCTATTGG - Intergenic
949809012 3:7985904-7985926 CGATACCTGGGCTTGGCTCTGGG - Intergenic
949829243 3:8196757-8196779 TGATTTCAGGTCTTGGCTCTTGG - Intergenic
950110178 3:10413713-10413735 GAATTCCAGGTGTTGGCTATGGG - Intronic
951029278 3:17863281-17863303 TGATTCCATGCCTTGGCTCTTGG - Intronic
951032217 3:17895347-17895369 CAATTCCAGGACATGGCTCTTGG - Intronic
951181940 3:19669099-19669121 TGATTCCAGGCCTTGACTCTTGG + Intergenic
951398722 3:22203560-22203582 CAGTTCTAGGCCTTGGCTCTTGG + Intronic
951495038 3:23316551-23316573 CAGTTGTAGGCCTTGGCTCTTGG - Intronic
952139812 3:30466054-30466076 TGATTCCAGGACTTGACCCTTGG - Intergenic
952203120 3:31151575-31151597 CAATTCCAGGACTTGACCTTTGG - Intergenic
952221970 3:31332286-31332308 CAAGTCCAGGCCTAGGCTCTTGG + Intergenic
952221976 3:31332315-31332337 CAATTCCAGAACTTGGCTCTTGG + Intergenic
952517936 3:34124621-34124643 CCATTCCAGGCCTTCGATCTTGG - Intergenic
952566849 3:34669259-34669281 CAGTTCCAGGCCTTGATTCTTGG + Intergenic
952688350 3:36175378-36175400 CAGTTCCAGGCTTTGGCTCCTGG - Intergenic
952811870 3:37411453-37411475 TGATTCCAGGCCTTGGCTTTTGG - Intronic
952912712 3:38204275-38204297 CAATTCCAGGCCTTGGCTCTTGG - Intronic
953309511 3:41863384-41863406 TGATTTCAGGACTTGACTCTTGG - Intronic
954078859 3:48200829-48200851 AAAATCCAGGACTTGCCTGTGGG - Intergenic
954488019 3:50872974-50872996 TGATTCCAGGACTTGGCTCTTGG - Intronic
954491695 3:50912889-50912911 CGATTCCAGGACTTGGCTCTTGG - Intronic
955274358 3:57533273-57533295 TGATTCTAGGCCTTGGCTCTTGG - Intronic
955441109 3:58956237-58956259 CAATTCCAGGACTTGGCTCTTGG + Intronic
956476134 3:69621951-69621973 CAATTCCAGGACTTGGCTCTTGG + Intergenic
956497699 3:69846437-69846459 CAAGTCTAGTCCTTGGCTCTTGG + Intronic
957621918 3:82604763-82604785 TGATTCCAGGACTTGACTCTTGG + Intergenic
957643136 3:82885060-82885082 CATTTCCAGTACTTGATTCTTGG + Intergenic
957685679 3:83501682-83501704 ACATTCCAGGAATTGGCTATGGG + Intergenic
957810442 3:85214894-85214916 CAATTCCAGGCCATGACTCCTGG - Intronic
957965846 3:87321834-87321856 TGATTCCAGAACTTGGCTTTTGG + Intergenic
958085279 3:88798210-88798232 CAACTACAGGCCTTGGCTCGTGG - Intergenic
958147140 3:89640190-89640212 CAATTCCAGGCCTTGGCTCCTGG + Intergenic
958482199 3:94657048-94657070 CCATTCCAGGACCAGGTTCTAGG + Intergenic
958617634 3:96515509-96515531 CAATTCCAGGACTTGAATCTTGG + Intergenic
958631182 3:96685747-96685769 TGATTCCAGGACTTGACTTTTGG - Intergenic
958757819 3:98271573-98271595 TGATTCCAGGACTTGGCTCCTGG - Intergenic
958874238 3:99597556-99597578 CAATTCCAGGACTTAATTATGGG - Intergenic
958876698 3:99624907-99624929 TGATTCCAGGACTTGGCTTTTGG + Intergenic
959118486 3:102206021-102206043 CAATTCTAGGCTGTGGCTCTTGG - Intronic
959127529 3:102308124-102308146 CGATTCCAGACCTTGGCTCCTGG + Intronic
959409045 3:105997681-105997703 TGATTTCAGGCCTTGGCTCTTGG - Intergenic
959414042 3:106062006-106062028 CAATTCCAGGACTTGACTCGTGG + Intergenic
959448278 3:106467191-106467213 CAATTCCAAGCCTTTGCTCTTGG - Intergenic
959474369 3:106791045-106791067 TGATTCCACGTCTTGGCTCTGGG + Intergenic
959717040 3:109444377-109444399 CGATTCCAGGCCTTGGCTCTTGG + Intergenic
959798111 3:110457079-110457101 CAATTCCAGGACTTGTCTCTTGG - Intergenic
959806588 3:110562008-110562030 CGATTTCAGGCTTTGGCTCTTGG - Intergenic
960016446 3:112894610-112894632 CATTTCCTGGCCTTGGCACTTGG + Intergenic
960067340 3:113387755-113387777 CAATTTCAAGCCTTAGCTCTTGG + Intronic
960153519 3:114274929-114274951 CACTTCCAGGCCTTGCCTCTTGG - Intergenic
960298060 3:115968133-115968155 TTATTCCAGGACATGGCTCTTGG - Intronic
960564932 3:119123053-119123075 TGATTCCAGGCCTTGGTTCTTGG + Intronic
960862741 3:122168342-122168364 CAATTCCAGACCTTGCCTCTTGG - Intergenic
961610424 3:128132947-128132969 CAATTCCAGGCCTTAGCTCCTGG + Intronic
961859981 3:129908701-129908723 GAATTCCAGGAACTGGCTTTAGG - Intergenic
961952321 3:130762681-130762703 CAATTATAGGCCTTGGCTCTTGG + Intergenic
962015179 3:131431803-131431825 CAATTCCAGGCCTTGGGTCTTGG + Intergenic
962078713 3:132114462-132114484 CAGTTTTAGGACTTGGCTCTTGG - Intronic
962151955 3:132902784-132902806 TGATTCCAGGACTTGACTCTTGG + Intergenic
962193594 3:133336753-133336775 TGATTCCAGGCCATGGCTCTTGG + Intronic
962264566 3:133935726-133935748 CAAGCCCAGGGCCTGGCTCTGGG + Intronic
962862618 3:139418801-139418823 CGATTCAAAGACTTGACTCTTGG - Intergenic
962998377 3:140653155-140653177 CGATTCAAGGCCTTGGCTCCTGG + Intergenic
963020449 3:140868599-140868621 TGATTCCAGGCCTTGGCTCTTGG - Intergenic
963067927 3:141278587-141278609 CAACTGCAGGACTTGGGTCCTGG - Intronic
963330561 3:143910338-143910360 CAAGTCCAGGCCTAGGCTTTGGG + Intergenic
963515324 3:146301387-146301409 CAATTCCAGGACTTGACCCTTGG + Intergenic
963591808 3:147269954-147269976 CAGTTGTATGACTTGGCTCTTGG + Intergenic
963802244 3:149687809-149687831 CAATTCCAGGCCTTAGCTCCTGG + Intronic
964059579 3:152505292-152505314 CAATTCCAGGACTTGACTCTCGG - Intergenic
964239511 3:154574831-154574853 TAACTCCAGGACTTGACTCTTGG + Intergenic
964253714 3:154750314-154750336 TGATTCCTGGCCTTGGCTCTTGG + Intergenic
964258863 3:154811219-154811241 CAACTCCAGGTCCTGGCTCCTGG - Intergenic
964349824 3:155791533-155791555 CAAGTCCAGGCTTAGGCTCTTGG + Intronic
964398424 3:156272646-156272668 TAATTCCAGGCCTTGGCTCCTGG - Intronic
964582887 3:158260016-158260038 CAATTCCAGGCCTTGAATCCTGG - Intronic
964992299 3:162828857-162828879 CAGTTCCAGGCCTTGGTTCCTGG + Intergenic
965016740 3:163167967-163167989 TAATTCCAGTACTTGACTCTTGG - Intergenic
965026183 3:163304203-163304225 TGGTTCCAGGACTTGACTCTTGG + Intergenic
965047518 3:163598132-163598154 TAATTCCAGGACATGGCTTTTGG + Intergenic
965099529 3:164278317-164278339 CCATTCCAGGCCCTAGCTCTTGG + Intergenic
965099587 3:164278681-164278703 CAGTTCCAGGATCTGGGTCTGGG + Intergenic
965175227 3:165322328-165322350 TAATTCTAGGCCTTGCCTCTTGG - Intergenic
965236866 3:166136112-166136134 TGATTTCAGGCCTTGGCTCTTGG - Intergenic
965260505 3:166478045-166478067 CAATTCCAGTCATTGGTTCTTGG + Intergenic
965317356 3:167208870-167208892 TGATTCCAGGCCTTGGCTCTTGG + Intergenic
965350933 3:167610246-167610268 CAATTCCAAGACTTGACTCTTGG + Intronic
965415169 3:168384306-168384328 CAAGTCCAGACCTAGGCTCTTGG - Intergenic
965867014 3:173216746-173216768 TGATTTAAGGACTTGGCTCTTGG - Intergenic
966348573 3:179005053-179005075 CCATTCCAGGACTTGGCTCTTGG + Intergenic
966400944 3:179546528-179546550 CAGTTCCAGCCCTTGGCTTTTGG + Intergenic
966491044 3:180529176-180529198 CAACTCCAGGACTTGATTCCTGG + Intergenic
966598690 3:181752497-181752519 CACTTACAGGACTTATCTCTAGG - Intergenic
967551127 3:190796912-190796934 TGATTCTAGGACTTGACTCTTGG + Intergenic
967632969 3:191768466-191768488 TGATTCCACGACTTGACTCTTGG + Intergenic
967677499 3:192317288-192317310 CAGCTCCAGGCCTTGGCTCCTGG + Intronic
968004972 3:195236533-195236555 CAGTTCCAGGCCTTGGCTCTGGG - Intronic
968429144 4:544986-545008 CAGTTCCAGAACTTGACTCTTGG - Intergenic
968893654 4:3385829-3385851 CAGATCCGGGGCTTGGCTCTGGG + Intronic
969860983 4:10035144-10035166 TACTACCAGGACTTGGCCCTTGG - Intronic
970413405 4:15833164-15833186 TGATTCCAGGATGTGGCTCTTGG - Intronic
970606375 4:17685827-17685849 CAACTTCAGCACTTGACTCTGGG - Intronic
970840418 4:20462082-20462104 CACTTCTCAGACTTGGCTCTGGG + Intronic
971567808 4:28167963-28167985 CAATTCCAGAACTTGGCACTTGG - Intergenic
971838677 4:31803087-31803109 TGATTCTAGGGCTTGGCTCTTGG - Intergenic
971861078 4:32106862-32106884 CATCTCCAGGACCTGGCACTTGG - Intergenic
971914508 4:32850786-32850808 CATTTCCAGGCATTGGCTCTTGG - Intergenic
972055469 4:34796725-34796747 CATTTCCAGGACATTGGTCTGGG - Intergenic
972237425 4:37150433-37150455 TAATTCAAGGACTTTACTCTTGG - Intergenic
972278422 4:37581177-37581199 TAATTCAAGGCCTTGGCTCTTGG - Intronic
972468755 4:39384016-39384038 TAATTCTAGGACTTAGCTCTTGG - Intergenic
972579211 4:40380030-40380052 CAGTTCCAGGCCTTGGCTCCTGG + Intergenic
972851625 4:43057462-43057484 TGATTCCAGGGCTTGACTCTTGG + Intergenic
973169355 4:47120410-47120432 CAGTTCCAGACCTTGGCTCATGG - Intronic
973327425 4:48877735-48877757 CACTTCCAGGACTTGGCTCTTGG - Intergenic
973329796 4:48901643-48901665 CAATTCCTGTAATTGGATCTGGG + Intronic
973919792 4:55673454-55673476 TGATTCCAAGCCTTGGCTCTTGG - Intergenic
974292348 4:59948658-59948680 CCATTCCAGGCCCTGGCTCCTGG + Intergenic
974301035 4:60067465-60067487 CAAGTCCAGGCATAGGCTCTTGG + Intergenic
974333167 4:60505823-60505845 TGATTCCAGGCCTTGGGTCTTGG + Intergenic
974337578 4:60570003-60570025 CGATTCCAGGACTTGACCCTTGG - Intergenic
975095311 4:70450383-70450405 CAATTCCAGGACTTGACTCTTGG - Intronic
975113543 4:70653141-70653163 GATTTCCAGGTCTTGGCTTTGGG - Intronic
975313121 4:72925425-72925447 CAATTCCAGGCTTTGGCTCTTGG - Intergenic
975365616 4:73524391-73524413 CCATTCCATGCCTTGGCTCCCGG - Intergenic
975502242 4:75099902-75099924 CAATTCCAGGACTTAACTCTTGG - Intergenic
976016439 4:80560519-80560541 CGATTCCAGGACTTGACTTTTGG + Intronic
976030002 4:80740980-80741002 CAAATCCAGGTCTAGGCTCTTGG - Intronic
976082818 4:81375322-81375344 TGATTCCAGGCCTTGGCTATTGG - Intergenic
976128655 4:81860412-81860434 CCATTCCAGGCCCTAGCTCTTGG + Intronic
976161267 4:82201798-82201820 CAATTCCAGGCCCTAGCTCCTGG + Intergenic
976254187 4:83083428-83083450 CGATTCCAGGACTTGACTGTTGG - Intergenic
976391010 4:84503405-84503427 TAATTCCAGGACTCGGGTTTTGG - Intergenic
976451851 4:85199568-85199590 TGATTCAAGGACTTGACTCTTGG - Intergenic
976525653 4:86084249-86084271 CAATTTCAAGATTTGGCTCTTGG + Intronic
976762765 4:88568408-88568430 CAACTCCAGGCCCTGGCTCATGG - Intronic
977307476 4:95342734-95342756 CAATTCCAGGCCTTGGCTCTTGG + Intronic
977393310 4:96441345-96441367 CAAATGCTGGCCTTGGCTCTTGG + Intergenic
977521846 4:98094546-98094568 CGAGTCCAGGCCTAGGCTCTTGG + Intronic
977753378 4:100635624-100635646 AGATTCCAGGACTTGACTCTTGG + Intronic
977985641 4:103379829-103379851 CACTTCCAAACCTTGGCTCTGGG + Intergenic
978088564 4:104686896-104686918 CAAATCCGGGACCTGGCTTTAGG + Intergenic
978116129 4:105022354-105022376 CAATTCCAGGCCTTGGCACTTGG + Intergenic
978116494 4:105025354-105025376 CAATTCCAGGACTTGACTCTTGG + Intergenic
978212644 4:106156802-106156824 CAATTCCAGGACTTGGCTCTTGG - Intronic
978261694 4:106768007-106768029 CCTTTCCAGGCCTTAGCTCTTGG + Intergenic
978733762 4:112061811-112061833 CCATTCCAGGTCTTAGCTCCTGG + Intergenic
978894640 4:113872473-113872495 GAATTCCAGAAATTGGCTTTAGG + Intergenic
978922417 4:114200643-114200665 TGATTCCAGGACTTGACTCTTGG - Intergenic
979073454 4:116240946-116240968 CAATTCCAGGCCTAGGATCTTGG - Intergenic
979184659 4:117772928-117772950 CAGTTCTAGGCCTTGGCTCCTGG + Intergenic
979504446 4:121479794-121479816 CAAGTCCAGGCCTGGGCTCTTGG - Intergenic
979594982 4:122525131-122525153 CCGATCCAGGACTTGACTCTTGG - Intergenic
979851282 4:125573741-125573763 CCATTCCAGGACTTGGATCTTGG - Intergenic
980413013 4:132447382-132447404 CGATTCCAGGACTTCACTCATGG + Intergenic
980442970 4:132871394-132871416 TGATTCTAGGACTTGCCTCTTGG + Intergenic
980646708 4:135652190-135652212 CAATCCCAGGCCTTGGCTTTTGG + Intergenic
980712756 4:136591530-136591552 AAATTCCAGGCCTGGGCTCTTGG + Intergenic
980885825 4:138761277-138761299 CTCTTACAGGTCTTGGCTCTTGG + Intergenic
980960548 4:139470490-139470512 AGATTTCAGGACTTGACTCTTGG - Intronic
981203804 4:142015407-142015429 TAATTCTAGGAGTTGGCTGTTGG - Intergenic
981298104 4:143156210-143156232 CAATTCCAGGACTTGGTCCTTGG - Intergenic
981394714 4:144234097-144234119 CAATTCTAGGCCTCGGCTCTTGG + Intergenic
981518339 4:145634500-145634522 CAGTTCCAGGCCTTGGCTCTTGG - Intronic
981895664 4:149796116-149796138 CAATTCCAGGACTTTACTCTTGG + Intergenic
981996168 4:150977605-150977627 CGATTCTAGGCTTTGGCTCTTGG + Intronic
982339866 4:154285438-154285460 TGATTCCGGGCCTTGGCTCTTGG + Intronic
982615320 4:157633827-157633849 TGATTCCAGGACTCGGTTCTTGG + Intergenic
982719756 4:158847705-158847727 CAGTTCCAGACATTGGCTCTTGG + Intronic
982911573 4:161148926-161148948 CAATTCCAGGCTTTGACTCCTGG + Intergenic
983493135 4:168412295-168412317 CAAGTGCAGGCCCTGGCTCTTGG + Intronic
983755444 4:171329122-171329144 CAGTTCCAGGACTTTGCTCTTGG + Intergenic
983931788 4:173460772-173460794 CGATTCCAGGACTTGATTCTTGG + Intergenic
984306828 4:178003469-178003491 AAATTCCAGGACATGTCTTTCGG + Intergenic
986155785 5:5174972-5174994 CAATTCCAGGCTTTGGCTCTTGG - Intronic
986548355 5:8924475-8924497 CAACTGCAGGCCTTGGCTCTTGG + Intergenic
986548402 5:8924771-8924793 CAACTCCAGGTCCTGGCTCCTGG + Intergenic
986756273 5:10839567-10839589 CTATTCCAGGACCTGGCTCCTGG + Intergenic
986756332 5:10839927-10839949 TGATTCCAGGACTTGACTTTTGG + Intergenic
986941375 5:12954199-12954221 CAATTCCAAGACTTGACTCTTGG + Intergenic
987616126 5:20276722-20276744 GGATTCTAGGCCTTGGCTCTTGG + Intronic
987631482 5:20478309-20478331 CAATTCAAGGCCTTGGTTCCAGG + Intronic
987903891 5:24050871-24050893 CGATTTCAGGCCTTGGCTCCCGG + Intronic
988001759 5:25358597-25358619 CAAGTCCAGGTCTAGGCACTTGG + Intergenic
988039824 5:25874663-25874685 CAATTCCAGGCCTTGGCTCTTGG - Intergenic
988082745 5:26433903-26433925 AAATTCCAGGCCTTGGCTCTTGG + Intergenic
988265306 5:28941795-28941817 CAATTCCAAGGCTTGCCTCTTGG - Intergenic
988299416 5:29403598-29403620 TGATTCCAGGACTTGACCCTTGG + Intergenic
988376247 5:30439495-30439517 TAATTCCAGGGCTTGGCTCCTGG + Intergenic
988608490 5:32703288-32703310 CAGTTCCAGGCCTTGGCTCTTGG - Intronic
989215315 5:38899369-38899391 TGATTCCAGGCCTTGGCTCTTGG - Intronic
989427822 5:41316564-41316586 CGATTCCAGGACTTCACTGTTGG + Intronic
989671702 5:43924925-43924947 TGATTCCAGGACTTGGCTCTTGG - Intergenic
989672628 5:43936373-43936395 CAGTTCCAAGGCTTGGCTTTTGG + Intergenic
989751169 5:44895576-44895598 CAATTCCAGGTCCTAGCTCCTGG - Intergenic
989970738 5:50521321-50521343 CAATTCCAGTACTTGGCTCTTGG - Intergenic
990194856 5:53303138-53303160 CAATTCTAGTACTTTGCTCTAGG + Intergenic
990202785 5:53397089-53397111 TGATTCCAGGCTTTGGCTCTTGG - Intergenic
990214213 5:53513163-53513185 CAAATCTAGGCCTTGGTTCTTGG - Intergenic
990578973 5:57150319-57150341 CAGTTCCAGGTTTTGGCTCTTGG - Intergenic
990592899 5:57283742-57283764 TGATTCCAGGACTTGACTCTTGG + Intergenic
990827953 5:59922913-59922935 CCATTCCAGGCCCTGGCTCTCGG + Intronic
990923789 5:60996082-60996104 CAGTTCTATGACTTGGCTCTTGG - Intronic
990933109 5:61115351-61115373 TGATTCTAGGCCTTGGCTCTTGG - Intronic
991180585 5:63746712-63746734 TAATTCCAGGACTTGACTCTTGG - Intergenic
991663638 5:68974639-68974661 CAATTCCAGGACTTGGCTCTTGG + Intergenic
991693770 5:69250617-69250639 TGAATCCAGGCCTTGGCTCTTGG - Intronic
991703881 5:69339628-69339650 CACTTCCATGACTTTGCTCCAGG - Intergenic
992309576 5:75482116-75482138 AAATTCCAGGCCTTGGCTCCTGG + Intronic
992454224 5:76901661-76901683 CAATTCCAGGACTTGACTCTTGG - Intronic
992587168 5:78252391-78252413 CAATTCTAGGACTTGGCTCTTGG + Intronic
992692709 5:79256371-79256393 TGATTCCAGGACTTGACTCTTGG - Intronic
993155610 5:84218616-84218638 CGATTCCAGGCCTTGGCTCTTGG + Intronic
993192143 5:84696365-84696387 TGACTCCAGGACTTGGGTCTTGG + Intergenic
993197234 5:84764599-84764621 CGATTCCAGGACGTGACTTTTGG - Intergenic
993287341 5:86016295-86016317 CAAGTCCAGGCCCAGGCTCTTGG - Intergenic
993580435 5:89653782-89653804 TGATTCCAGGACTTGATTCTTGG + Intergenic
993623331 5:90193196-90193218 GGATTCCAAGACTTAGCTCTTGG + Intergenic
993981272 5:94545918-94545940 CAAGTCGAGGCCTAGGCTCTTGG + Intronic
994028576 5:95114358-95114380 CAATTACAGGCCTTGGCTCTTGG + Intronic
994217842 5:97159051-97159073 TGATTCCAGGCCTTGGCTCTTGG - Intronic
994264646 5:97700369-97700391 CAAGTTTGGGACTTGGCTCTTGG + Intergenic
994477662 5:100290964-100290986 TGATTCCAGGACTTGACTCTTGG - Intergenic
994633919 5:102320649-102320671 CAGTTCCAAAACTTGACTCTTGG - Intergenic
994714148 5:103301688-103301710 CATTGCCAGGGCTTGGCTCTGGG + Intergenic
994974122 5:106780169-106780191 CAATTCCAGGCGTTGGCTCTTGG + Intergenic
995019534 5:107351675-107351697 CAACTCCAGGCCTTAGCTCCTGG - Intergenic
995268623 5:110194878-110194900 CAGTTCCAGGCCTTGGTGCTTGG - Intergenic
995770625 5:115665423-115665445 CAGTTCCAGGCTTTGGCACTTGG + Intergenic
996259330 5:121446311-121446333 TAAGTCCAGGCCTAGGCTCTTGG + Intergenic
996594492 5:125185415-125185437 TGATTCCAGGACTTGCCTCTTGG + Intergenic
996699273 5:126433919-126433941 CTATTCCAAGAATTGGCTCCAGG - Intronic
996931674 5:128896456-128896478 CCATTCCAGGCCTTAGCTCCTGG - Intronic
996945041 5:129056281-129056303 CAGTTCCAGGCCTTGTCTCTTGG + Intergenic
996968297 5:129331662-129331684 TGATTCCAGGTCTTGCCTCTTGG + Intergenic
997003055 5:129784947-129784969 TGATTCCAGGCCTTAGCTCTTGG + Intergenic
997071984 5:130633232-130633254 TGATTCCAGGCCTTGGCTCTTGG - Intergenic
997186252 5:131884738-131884760 TAATTCCAGGCCTTGGCTCTTGG + Intronic
997832614 5:137164294-137164316 CAATTCCAGGCTGTAGCTCTTGG + Intronic
998291182 5:140916227-140916249 CAAGTCCAGGCTTTGGCTCCTGG - Intronic
998507899 5:142686705-142686727 CATTTGTAGGGCTTGGCTCTGGG - Intronic
998670377 5:144346927-144346949 AATCTCCAGGACTTGGGTCTGGG - Intronic
999345658 5:150816984-150817006 CAATCCCAGGACTTGACTCTTGG + Intergenic
999400746 5:151262539-151262561 CATATCCAGGACTTGTGTCTGGG - Intronic
999406575 5:151312294-151312316 CAATTCCAGGACTTGGCTCTTGG - Intergenic
999849482 5:155523154-155523176 TGATTCCAGGCCTTGGCTCTTGG - Intergenic
1000270242 5:159677239-159677261 CAAGTCCAGGACTTGACTCTTGG + Intergenic
1000399485 5:160811385-160811407 TGATTCCAGGCCTTGGCTCTTGG + Intronic
1000454940 5:161437604-161437626 CTATTCCAGGACCTGACACTTGG + Intronic
1000651317 5:163822073-163822095 CAATTCCAGGACTTGATTATTGG - Intergenic
1001177671 5:169486971-169486993 CAATTCCAGGACTTGGCTCTTGG + Intergenic
1001686690 5:173598773-173598795 AAGTTCCAAGACTTGGGTCTAGG + Intergenic
1003323765 6:5076384-5076406 CAAAGCCAGGATTTGGCTCAAGG - Intergenic
1003437940 6:6111336-6111358 TGATTCCAGGACTTGGCTCTTGG - Intergenic
1004251474 6:14026449-14026471 CACTTCCTGCACTTGGCTTTCGG - Intergenic
1004282778 6:14294860-14294882 CGACTCCAGGCCTTGGCTCTTGG - Intergenic
1006462956 6:34174468-34174490 CGATTCCAGACCTTAGCTCTTGG - Intergenic
1006963747 6:37961109-37961131 TGATTCCAGGACTTGGCTCTTGG + Intronic
1007001631 6:38319198-38319220 CAATTCCAGGTCTTGGCTCTCGG - Intronic
1008017876 6:46541715-46541737 TGATTTCAGGACTTGGCTCTTGG + Intergenic
1008177603 6:48288047-48288069 CAATTTCAGGGCTTGACTCTTGG - Intergenic
1008227278 6:48936258-48936280 CATTTCCAGGCCTTGGCTCTTGG - Intergenic
1008304582 6:49886078-49886100 TGATTCCAGGCCTTGGCTCCTGG - Intergenic
1008642016 6:53473973-53473995 TGATTCCAGGCCTTGGCTCTTGG - Intergenic
1008752820 6:54757617-54757639 CAATTCCAGGACTTGACTCATGG - Intergenic
1008880774 6:56378282-56378304 CGATCCCAGGACTCAGCTCTTGG + Intronic
1009245467 6:61231796-61231818 TGATTCCAAGACTTGACTCTTGG + Intergenic
1009309020 6:62126050-62126072 CAGTTCCAAGCCTTGGCTATTGG + Intronic
1009309073 6:62126362-62126384 CAATTCTAGGCCCTGGCTCCCGG + Intronic
1009353142 6:62707510-62707532 TGATTCTAGGACTTGACTCTTGG - Intergenic
1009353402 6:62709385-62709407 CAATTCTGGGCTTTGGCTCTTGG - Intergenic
1009390744 6:63140412-63140434 TAATTCCAGGACTTGACTCTTGG + Intergenic
1009782948 6:68293513-68293535 CAGTTCCAGGGCTTGACTCTTGG + Intergenic
1009978504 6:70699838-70699860 AGATTCCAGGCCTTGGCTCCTGG - Intronic
1010139908 6:72602231-72602253 CAATTCCAGGACATGGCTCTTGG - Intergenic
1010299488 6:74243523-74243545 TGATTCCAGGACTTGACTCTTGG - Intergenic
1010325077 6:74554941-74554963 CATTTGCAGGACTGGACTCTTGG + Intergenic
1010438405 6:75863185-75863207 ACATTCCAGGAGTTGGCACTCGG + Intronic
1010838831 6:80623475-80623497 CAAGTCCAAGCCTAGGCTCTTGG + Intergenic
1011019023 6:82789770-82789792 CAAATCCAGGCCCTGGCTCCTGG + Intergenic
1011291150 6:85778845-85778867 TGGTTCCAGGCCTTGGCTCTTGG - Intergenic
1011783935 6:90822762-90822784 ATTTTCCAGGACTTGGCTATAGG + Intergenic
1011914599 6:92488180-92488202 CAGTTCCAGGACTCGGCTCTTGG - Intergenic
1012049950 6:94328758-94328780 TAATTCCAAGACTTGACTCTTGG + Intergenic
1012253175 6:97002315-97002337 CAATTCCTTGACTTGCTTCTGGG + Intronic
1012557611 6:100535006-100535028 CAATTTCAGGACTTGGAAGTAGG - Intronic
1012616725 6:101286398-101286420 CAATTTCAGAACCTGGCTGTGGG - Intergenic
1012620601 6:101339650-101339672 CAATTCTAGGATTTGCCTCTTGG - Intergenic
1012678951 6:102154204-102154226 TGATTCCAGGGCTTGACTCTTGG + Intergenic
1012715275 6:102660894-102660916 CTTTTACAGGACTTGTCTCTTGG + Intergenic
1012761636 6:103309953-103309975 TGATTCCAGGACTTGGTTCTTGG + Intergenic
1012782938 6:103586159-103586181 AAATTCCAGGACATTGGTCTGGG - Intergenic
1013687470 6:112601742-112601764 CAATTCCAGGCCTTAGCTCTTGG + Intergenic
1013925609 6:115468230-115468252 CAATTCTAGGACTTGACTCTTGG - Intergenic
1014165996 6:118225559-118225581 ATATTCCAGGACGTTGCTCTAGG + Intronic
1014234641 6:118940458-118940480 CAGTTCCAGGATTTGACTCTTGG + Intergenic
1014542407 6:122692625-122692647 CAATTCTAGGCCTTGGCTCTTGG - Intronic
1014855538 6:126396489-126396511 TGATTCCAGGCCTTGGCTCTTGG - Intergenic
1014862278 6:126484720-126484742 CAATTCCCGGCCTCAGCTCTTGG + Intergenic
1014865239 6:126521198-126521220 CAATTCCAGGACATGAATCTTGG - Intergenic
1015392954 6:132703072-132703094 CAATTCCAGGACTTAGCTCCTGG + Intronic
1015460727 6:133487940-133487962 TGATTCCAGGCCATGGCTCTTGG + Intronic
1015578799 6:134701630-134701652 CAATTCCAGGCCTTGGCTCTTGG - Intergenic
1015925968 6:138310974-138310996 CCAATCCAGGACTTGTCTCTGGG + Intronic
1015959459 6:138631926-138631948 CGATTCTAGAACTTGGCTCTTGG + Intronic
1016054736 6:139566821-139566843 CAATTCCAGGCTTTGGCTCCTGG - Intergenic
1016061571 6:139636359-139636381 CACTTCCAGGCCTTGGCTCTTGG - Intergenic
1016151223 6:140745326-140745348 TGATTCCAGGACTTGACTCTTGG + Intergenic
1016185718 6:141195900-141195922 TGATTCCAGGACTTGACTCTTGG - Intergenic
1016288768 6:142504985-142505007 CAAATCCAGGAGTTGGTTTTTGG - Intergenic
1016457354 6:144245018-144245040 CAATTCCAAGCCTTGGCTCTTGG - Intergenic
1016623797 6:146142832-146142854 CGATTCCAGGCCTTGGTTCTTGG - Intronic
1016643031 6:146372536-146372558 CATTTCCAGGACATTGATCTGGG - Intronic
1017243431 6:152196216-152196238 CAATTCCAGGACTTGGCTCTCGG - Intronic
1017379658 6:153813787-153813809 TCATTCCAGGACTTGACTCTTGG + Intergenic
1018316574 6:162562403-162562425 CAGTTCCAGGACTTGACCCTTGG + Intronic
1018535800 6:164818023-164818045 CAGTTCCAGAACTTGGCTCTTGG + Intergenic
1018716862 6:166539755-166539777 CATTTCCAGGGCCTGGCACTTGG - Intronic
1019008516 6:168823710-168823732 CACTTCCAGCACTTGGCTGACGG + Intergenic
1019672538 7:2289264-2289286 ACATTCCAGCACGTGGCTCTTGG + Intronic
1020519970 7:9173286-9173308 TAATTACAGGACTTGACCCTTGG - Intergenic
1020574802 7:9913111-9913133 CAGTTCAAGGACTTGGCTTTGGG - Intergenic
1020607370 7:10356174-10356196 CAAGTTCAGGAATAGGCTCTTGG - Intergenic
1020613133 7:10426259-10426281 TGATTCCAGGACTTGGCTCTTGG - Intergenic
1020812681 7:12864995-12865017 CAATTTCAGGCCTTGGCTCTTGG + Intergenic
1020912614 7:14151958-14151980 AAATTCCAGGTGTAGGCTCTAGG + Intronic
1021034815 7:15785005-15785027 CGATTCCAGGACTTCCCTCTTGG + Intergenic
1021046156 7:15925298-15925320 CAATTCTAGCCCTTGGCTCTTGG + Intergenic
1021130999 7:16913087-16913109 CAATTCCAGGACTTGACTCTTGG - Intergenic
1021203557 7:17753152-17753174 CATTTGCAGAACTTGGCTCTTGG - Intergenic
1021923107 7:25506540-25506562 CAATTCCAGGCCCTGGCTCCTGG + Intergenic
1022080218 7:27012756-27012778 CGATTCCAGGACTTGATTATTGG + Intergenic
1022223575 7:28340075-28340097 CAATTTCAGGCCTTGGCTCTTGG - Intronic
1022348259 7:29539278-29539300 CAATTCCAGAATTTGGCTCTTGG + Intergenic
1022366965 7:29730639-29730661 CGATTCCAGGCCTTGGCTCTTGG - Intergenic
1022416794 7:30185300-30185322 CAATTCCTGGTTTTGGATCTGGG + Intergenic
1022741119 7:33122665-33122687 CAATTCCAAGACTTGGCTCTTGG - Intergenic
1022749861 7:33213421-33213443 CAAGTCCAGGCTTAGGCTCTTGG - Intronic
1022758932 7:33326422-33326444 CAATTCTAATCCTTGGCTCTCGG - Intronic
1024661254 7:51497387-51497409 TGATTCCATGACTTGACTCTTGG - Intergenic
1024662407 7:51510971-51510993 TGATTCCAGGCCTTGGCTCTTGG - Intergenic
1024891694 7:54211083-54211105 CATTTCCAAGACTTGACTCTTGG + Intergenic
1024968384 7:55046219-55046241 TACTTCCAGCCCTTGGCTCTTGG + Intronic
1027604907 7:80288181-80288203 TAATTCCAGGCCTTGGCACTTGG + Intergenic
1027799353 7:82732715-82732737 CCATTCCAGGACGTTGCTCCTGG + Intergenic
1028001383 7:85502170-85502192 AAATTCTAGGACTTCACTCTTGG + Intergenic
1028022432 7:85792940-85792962 CAGTTCCAGGCCTTAGCTCCTGG + Intergenic
1028181509 7:87730288-87730310 CAGTTCTAGGCCCTGGCTCTTGG + Intronic
1028868087 7:95736567-95736589 CAATTCTAGGCCTAGGCTCCTGG - Intergenic
1028929525 7:96397562-96397584 CAGCTCTAGGCCTTGGCTCTTGG - Intergenic
1028950567 7:96630569-96630591 CAATTCCAGGAGTTGGCTCTTGG - Intronic
1029825301 7:103186816-103186838 CGATTCCAGGCCTTGGCTCTTGG + Intergenic
1030662702 7:112238757-112238779 CCATTCCAGGCCCTGGCTCCTGG + Intronic
1031231605 7:119114423-119114445 TGATTACAGGACTTGACTCTTGG - Intergenic
1031260098 7:119507335-119507357 CAATTCTAGGCCCTGGCTCTTGG + Intergenic
1031442575 7:121812189-121812211 GGATTCCAGGACGTGGCTGTTGG + Intergenic
1031472438 7:122182800-122182822 CAATTTCAGGCCTTGGCTCTGGG + Intergenic
1031546112 7:123053133-123053155 CAACTCCAGGCCCTGGCTCCTGG - Intergenic
1031546158 7:123053444-123053466 CATTTCCAGGCCTTGGCTCTTGG - Intergenic
1031553351 7:123142379-123142401 TGATTCCTTGACTTGGCTCTTGG - Intronic
1032972040 7:137175346-137175368 CGATTCTAGGACTTGACTCTTGG + Intergenic
1033541967 7:142365578-142365600 GGATTCCAGGACTTTGCTGTTGG - Intergenic
1033691340 7:143740484-143740506 CAATTCTAGGACTTGACTCTTGG + Intergenic
1033833606 7:145282729-145282751 TGATTCCAGGACTTAGTTCTTGG - Intergenic
1033867773 7:145713537-145713559 TTATTCCAGGCCTTGGGTCTTGG - Intergenic
1033877642 7:145842372-145842394 CGATTGCAGGCCTTGGCTCCTGG - Intergenic
1034003422 7:147442446-147442468 TAATTCCAGCACTTGGCTCCTGG - Intronic
1034581712 7:152049752-152049774 CAACTCCAGGACCTGGCTCCAGG - Intronic
1034581768 7:152050048-152050070 TGATTTCAGGCCTTGGCTCTTGG - Intronic
1034847737 7:154463076-154463098 CAATTCTAGGCCTTGGTTCTTGG - Intronic
1037034139 8:14144687-14144709 CAGCTCCAGGACTTGACTCTTGG + Intronic
1037354133 8:17999088-17999110 CAATTCGAGAACCTGGCTCCTGG - Intronic
1039002323 8:32995323-32995345 CAATTCTGAGACTTGGCTCTTGG - Intergenic
1039647441 8:39303306-39303328 CAGTTCCAGGACTTGCATCTTGG - Intergenic
1039663713 8:39496067-39496089 TGATTCCAGGACTTGGCTCTTGG + Intergenic
1040628160 8:49175811-49175833 AGATTCCAGGACTTGGCTATTGG + Intergenic
1041416035 8:57609611-57609633 CGATTCCAGGCCTTGGTTCTTGG + Intergenic
1041506836 8:58608526-58608548 CATTTCCAAGACCTGACTCTGGG - Intronic
1041562069 8:59229428-59229450 CAAATCCAGGAGTTGGTTTTTGG + Intergenic
1041582905 8:59483396-59483418 CCATTCCAGGCCTTAGCTCATGG - Intergenic
1041606940 8:59792916-59792938 CGATTCCAGGCCTTGGCTCCTGG + Intergenic
1041616052 8:59907726-59907748 CAATTCCAGGCCTCAGCTCTTGG + Intergenic
1041943040 8:63409547-63409569 CTGATACAGGACTTGGCTCTGGG - Intergenic
1041968842 8:63713351-63713373 CATTTGCAGGACTTTGCTTTAGG + Intergenic
1042082524 8:65071009-65071031 CGATTCCAGGCCTTGGCTCCCGG - Intergenic
1042297954 8:67242725-67242747 TTATTCCAGGCCTTGGCTCTGGG + Intronic
1042428200 8:68673343-68673365 CAATTCCAGGCGTGTGCTCTTGG + Intronic
1042726850 8:71888321-71888343 CGATTCCAGGACTTGACTCTTGG - Intronic
1042980322 8:74519194-74519216 CAACTCCAGGTCCTGGCTCCTGG + Intergenic
1043227069 8:77746192-77746214 TGAGTCCAGGCCTTGGCTCTTGG + Intergenic
1043340261 8:79229535-79229557 CAGTTTCAGGACTTGATTCTTGG - Intergenic
1043567353 8:81562479-81562501 CAATTCTAGGCCTTGGCTCTTGG + Intergenic
1044026205 8:87175539-87175561 CCATTCAAGGCCTTAGCTCTTGG - Intronic
1044483936 8:92727491-92727513 CTATTCCAGGACTGCCCTCTGGG - Intergenic
1044532366 8:93321909-93321931 CAAAACCAGGGTTTGGCTCTAGG + Intergenic
1045172517 8:99686797-99686819 CAATTCCAGGCCTTGGTTCTTGG - Intronic
1046169429 8:110485783-110485805 CAATTTCAGGACTGGACTCTTGG + Intergenic
1047901112 8:129423255-129423277 TGATTCCAGGCCTAGGCTCTTGG + Intergenic
1047910132 8:129518660-129518682 CAATACCAGGACTTGGCTCTCGG + Intergenic
1048029869 8:130621193-130621215 CAATTCCAGGCCTTGGCTCCTGG - Intergenic
1048218739 8:132521120-132521142 CAAGTCCAGGGCATGGCTTTTGG - Intergenic
1048268506 8:133009037-133009059 GAATGGCAGGACTTGGCTCCAGG + Intronic
1048271629 8:133032994-133033016 GAAATACAGGACTTGGCTTTAGG - Intronic
1048757808 8:137757140-137757162 TGATTCCAAGCCTTGGCTCTTGG + Intergenic
1049228029 8:141466971-141466993 CACTTGCAGGACTTGGCACTGGG + Intergenic
1050013888 9:1212557-1212579 CGATTCCAGGGCCTGCCTCTCGG + Intergenic
1050083852 9:1943305-1943327 CAATGCCAGGATTTGGAGCTAGG + Intergenic
1050238811 9:3612773-3612795 TGATTCCAGGCCTTGGCTTTTGG - Intergenic
1050865179 9:10488895-10488917 TGATTCTAGGACTTGGCTATTGG - Intronic
1050913964 9:11108129-11108151 CAATTCTAAGACTTGGCTTTTGG + Intergenic
1051047218 9:12889105-12889127 CAAGTCCAGGCCTAGGCTCTTGG + Intergenic
1051921773 9:22275124-22275146 GATTTCCAGAACTTGACTCTTGG + Intergenic
1051966644 9:22836211-22836233 CAGTTCCAAGCCTTGGCTCTTGG - Intergenic
1051992099 9:23163626-23163648 CAAGTCCAGGCCTAGACTCTTGG + Intergenic
1052063320 9:23987174-23987196 CAATCCCAGGACTTGACTCTTGG + Intergenic
1052258774 9:26491021-26491043 TGTTTCCAGGACTTGACTCTTGG - Intergenic
1052685890 9:31755551-31755573 CAATCCCAGGATTTTGCTCAGGG - Intergenic
1054982601 9:71223610-71223632 CAATTCCAGGCCTTGGCTCTTGG + Intronic
1055007438 9:71524839-71524861 GGATTCCAGGACTTTCCTCTTGG + Intergenic
1055181198 9:73388822-73388844 CAAGTCCAAGACTAGACTCTTGG - Intergenic
1055302070 9:74892243-74892265 TAATTCCAGACCTTGGCTCTTGG + Intergenic
1056003988 9:82247624-82247646 CATTTCCAGGCTTTGGCTCTTGG - Intergenic
1056230564 9:84538866-84538888 TGATTCCTGGCCTTGGCTCTTGG - Intergenic
1056338846 9:85603690-85603712 CAATTTCAGGCCTTGGCTTCTGG + Intronic
1056516778 9:87359643-87359665 TGATTTCAGGCCTTGGCTCTTGG + Intergenic
1057198631 9:93128702-93128724 CCATCCCAGGACTTGGTGCTGGG + Intronic
1058138511 9:101334193-101334215 CATTTCCAGGCCTTTGCTCTGGG - Intergenic
1058226509 9:102371246-102371268 CGATTCCAGAACTTGACTCTTGG - Intergenic
1058285239 9:103169291-103169313 CAATTCCAGGACTTGGTGCTTGG - Intergenic
1058522790 9:105828577-105828599 TAATTCCAGGGCTTGGCTCCTGG - Intergenic
1058780184 9:108325406-108325428 TGATTCCAGAACTTGACTCTTGG + Intergenic
1058820959 9:108728861-108728883 CAACTCCAGGCCCTGGCTCCTGG + Intergenic
1059515404 9:114889707-114889729 CGATTCCAGGACTTGATTCTTGG + Intergenic
1059555464 9:115276247-115276269 TGATTCCAGGACTTGGCTCGTGG - Intronic
1059839099 9:118192067-118192089 TGATTCCAGGCCTTGGCTCTTGG + Intergenic
1060166687 9:121422984-121423006 CAATTCCAGGACTTGGCTTCTGG - Intergenic
1060328665 9:122643820-122643842 CCATTCCAGGCCCTAGCTCTGGG + Intergenic
1061418303 9:130460032-130460054 CAATTCCTGTACCAGGCTCTTGG - Intronic
1061484343 9:130912756-130912778 CATCTCCAGCACTTTGCTCTGGG + Intronic
1061915575 9:133751458-133751480 CGATTCCAGGACTTGACTCTTGG - Intergenic
1062198913 9:135290414-135290436 CAAGTCCAGGACTTGTCTGGAGG - Intergenic
1062375103 9:136258520-136258542 CAAATTGGGGACTTGGCTCTCGG + Intergenic
1186602132 X:11049491-11049513 CAGTTCCAGGCCTTGGCTTTTGG - Intergenic
1187140478 X:16588351-16588373 CAATTCCAGGAACTGGCCTTAGG - Exonic
1187579309 X:20591646-20591668 CAAATCCAGGCCTGGGCTCTTGG - Intergenic
1187588471 X:20689908-20689930 CAAGTCCAGGCCTAGGCTCTTGG - Intergenic
1187610572 X:20938981-20939003 TAACTCTAGGACTTGACTCTTGG - Intergenic
1187618688 X:21026950-21026972 TGATTCCAGAATTTGGCTCTTGG - Intergenic
1187652050 X:21420340-21420362 CAATTCTAGGACTTGGCTCTTGG - Intronic
1187735725 X:22302109-22302131 CAAATCCATGCCTTGGCCCTGGG + Intergenic
1188040539 X:25366337-25366359 CGATCCCAGGACTTGTCTCTTGG - Intergenic
1188046240 X:25428567-25428589 CAATTCTAGAATTTGACTCTTGG - Intergenic
1188068866 X:25695182-25695204 AGATTCCAGGACTTGACTCTTGG - Intergenic
1188191963 X:27182602-27182624 CAATTCCAGACCTTGGCTCCTGG + Intergenic
1188192022 X:27182912-27182934 CAACTCCAGGACCTGGCTCCTGG + Intergenic
1188210638 X:27419506-27419528 TGATTCCAGGACTTGACTCTTGG + Intergenic
1188421109 X:29991760-29991782 CAATTCCAGGCCTTGCCTCTTGG - Intergenic
1188715638 X:33456552-33456574 CAATTCTAGAACTTGGCTCTTGG + Intergenic
1188721509 X:33528529-33528551 TGATTCTATGACTTGGCTCTTGG - Intergenic
1188749984 X:33893312-33893334 CAGTTCCAGAACTTGGCTCTTGG - Intergenic
1188815302 X:34705573-34705595 CGATTCCAAGACTTGACTCTTGG - Intergenic
1188846285 X:35076443-35076465 CGATTCCAGAACTTGGCTCTTGG - Intergenic
1188897455 X:35686575-35686597 CAAGTCCAGGCCTAGGCTCTTGG + Intergenic
1188924608 X:36023896-36023918 CAATTCCAGAACTTGGCTCTTGG - Intergenic
1188932043 X:36123724-36123746 CGATTCCAGAACTTGACTTTTGG - Intronic
1188972294 X:36632742-36632764 CAATTCCAGGCTTTGGATCTTGG - Intergenic
1188996111 X:36887910-36887932 CAATTTCAGGCCTTGGATTTTGG + Intergenic
1189019614 X:37320540-37320562 CAATTCCAGGATTTGGCTCTTGG + Intergenic
1189405747 X:40721201-40721223 CAAGTCCAGGCCTAGGCTCTTGG + Intronic
1189640787 X:43068312-43068334 CGATTCTAGGCCTTGGCTCCTGG + Intergenic
1189657977 X:43267162-43267184 CGATTCCAGGACTTGGCTCTTGG - Intergenic
1189670232 X:43400549-43400571 CAATTCTAGGGCTTGACCCTTGG + Intergenic
1189688095 X:43586820-43586842 CTATTCCAGGGCTTGGCTAATGG + Intergenic
1189770046 X:44416618-44416640 TGATTCCAGGACTTGGCTCTTGG - Intergenic
1189868773 X:45360452-45360474 TGATTCTAGGACTTGGCTCTTGG - Intergenic
1189870042 X:45371776-45371798 CAATTCCAGGACTTGGCTCTTGG + Intergenic
1189890030 X:45591549-45591571 TGATTCCATGCCTTGGCTCTTGG - Intergenic
1189935759 X:46066853-46066875 CAATTCCAGGACTTGGCTCTTGG - Intergenic
1190537749 X:51446553-51446575 TGATTGCAGGACTTGGCTCTTGG - Intergenic
1190614602 X:52217501-52217523 TGATTCTAGGACTTGACTCTTGG + Intergenic
1190893866 X:54596981-54597003 CAATTCCAGGACGTGACTCTTGG - Intergenic
1190907877 X:54746316-54746338 CAATTCCAGGTATTGGATCTTGG - Intergenic
1191083417 X:56538118-56538140 CAGTTCTAGGACTTGACTCTTGG + Intergenic
1191149857 X:57209114-57209136 CAATTCCAGGACTTGGTTCTTGG - Intergenic
1191198625 X:57752515-57752537 CAATTCTAGAACTTGGCTCTTGG + Intergenic
1191221950 X:57998761-57998783 CGATTTCAGGACTTGACTCTTGG + Intergenic
1191593205 X:62912122-62912144 TTATTACAGGCCTTGGCTCTTGG - Intergenic
1191829596 X:65402021-65402043 CAGTTTCAGGACTTCACTCTTGG + Intronic
1191949378 X:66571957-66571979 CCATTCCAGAACTTGACTTTTGG - Intergenic
1192020426 X:67385354-67385376 CAGTTCCAGGCCTTGGTTCTTGG + Intergenic
1192027165 X:67466084-67466106 TGATTCCAGGACTTGAGTCTGGG + Intergenic
1192045988 X:67674738-67674760 TGATTCCAGGCCTTGGCTCTTGG - Intronic
1192062181 X:67838940-67838962 CAATTCCAGGGCTTGGCTCTTGG + Intergenic
1192304417 X:69944112-69944134 AAATTCTAGGCCTCGGCTCTTGG - Intronic
1192304481 X:69944468-69944490 CCATTCCAGGCCCTGGCTCCTGG - Intronic
1192374890 X:70549474-70549496 CGGTTCCAGGCCTTGGCTCTTGG + Intronic
1192397302 X:70795037-70795059 CAATTCCAGACCTTGACTCTTGG + Intronic
1192406032 X:70887280-70887302 GGATTCCAGTCCTTGGCTCTTGG + Intronic
1192640715 X:72859521-72859543 CAAGTCCAGGCCTAGGCTCTTGG + Intergenic
1192640996 X:72861255-72861277 CAAGTCCAGGCCTAGGCTCTTGG - Intergenic
1192676225 X:73199544-73199566 TAATTCCTGGAATTGGCTCTTGG + Intergenic
1192679964 X:73242082-73242104 CAATGCCAGTCTTTGGCTCTTGG + Intergenic
1192725933 X:73752201-73752223 TGATTCCAGGACTTGACTCTTGG - Intergenic
1192822392 X:74658543-74658565 CAGTTCCAGCACCTGACTCTTGG - Intergenic
1192836137 X:74801767-74801789 CAATTACAGGCTCTGGCTCTTGG + Intronic
1192853302 X:74980640-74980662 CAAATCTAGGACTTGACACTTGG + Intergenic
1192908537 X:75578764-75578786 CAATTCCAGGACTTGAATCTTGG - Intergenic
1192968542 X:76206275-76206297 CAATTTCAGGACTTGACTCTTGG - Intergenic
1192977995 X:76306686-76306708 CAATTCCAGACCTTGACTCTAGG - Intergenic
1193016412 X:76738779-76738801 TGATTCCAGGACTTGACTCTTGG + Intergenic
1193092577 X:77510498-77510520 TAATTCCAGGCCTTGGCTTTTGG + Intronic
1193173017 X:78358343-78358365 TGATTCCAGGACTTGACTCTTGG - Intergenic
1193175179 X:78384313-78384335 CAATTCCAGGACTTGACTCTTGG + Intergenic
1193213919 X:78840142-78840164 CAATTCCAGGCTGTGGCTCCCGG + Intergenic
1193220049 X:78913505-78913527 CAATTCCAGGCCAAGGCTCTGGG - Intergenic
1193242996 X:79194860-79194882 TGATTTCAGGACGTGGCTCTTGG + Intergenic
1193260794 X:79404207-79404229 CGATTCCAGGACTTAACTCTTGG + Intergenic
1193280326 X:79641355-79641377 CAATTCCAGGCCTTGGCTCTTGG - Intergenic
1193283672 X:79686205-79686227 CAATTCCAGGCCTTGTCTCTTGG - Intergenic
1193293390 X:79805279-79805301 AGATTCCAAGACTTGACTCTTGG - Intergenic
1193297131 X:79846456-79846478 TGATTCCAAGATTTGGCTCTTGG - Intergenic
1193366236 X:80637342-80637364 CAGTTCCAGGTGTTGGCTCTTGG - Intergenic
1193417081 X:81238199-81238221 TGACTCCAGGACTTGACTCTTGG + Intronic
1193463429 X:81817745-81817767 CAACTCCAGGCCCTGGCTCCTGG - Intergenic
1193469214 X:81878692-81878714 CAATTCCAGGCCATAGCTCTAGG - Intergenic
1193555759 X:82951818-82951840 CAGTTTTAGAACTTGGCTCTTGG - Intergenic
1193585091 X:83311471-83311493 TAATTCCAGGATTTGGCTCTTGG + Intergenic
1193596409 X:83451481-83451503 TGATTCCAGGATTTGACTCTTGG - Intergenic
1193676088 X:84454281-84454303 CGATTCCAGGGCTTGGCTCTTGG + Intronic
1193697238 X:84723993-84724015 CAATTCCAGGACTTGACATCTGG - Intergenic
1193742360 X:85232498-85232520 TGAATCCAGGCCTTGGCTCTTGG + Intergenic
1193755883 X:85408351-85408373 CGATTCGAGGACTTGGCTCTTGG - Intergenic
1193760771 X:85462762-85462784 TAATTCCAGGATGAGGCTCTTGG + Intergenic
1193876573 X:86869157-86869179 CAATTCTAGTACTTGACTCTTGG - Intergenic
1193897033 X:87127223-87127245 GGATGCCAGGCCTTGGCTCTTGG + Intergenic
1193899608 X:87161358-87161380 CTATTCCAGGCCTTGGCCCCTGG - Intergenic
1193905846 X:87243385-87243407 CTATTCCAGGCATTGGCTTTTGG - Intergenic
1193907594 X:87261764-87261786 CAATTTCAGGACTTTATTCTTGG + Intergenic
1193912027 X:87317397-87317419 TGATTCCAGGCCTTGGCTTTTGG - Intergenic
1194023560 X:88723773-88723795 CAATTCCAGGACTTGACTCTTGG + Intergenic
1194065295 X:89253455-89253477 AAATTTTAGGACTCGGCTCTTGG + Intergenic
1194110236 X:89824662-89824684 CAATTCTAGGCTTTGGCTCTTGG + Intergenic
1194115189 X:89888258-89888280 CAGTTCCAGGACTGGGCTCTTGG - Intergenic
1194157855 X:90415510-90415532 CAATTCCAGAACATGATTCTTGG - Intergenic
1194165083 X:90505932-90505954 TGATCCCAGGACTTGACTCTTGG + Intergenic
1194189388 X:90816205-90816227 GAATTCAAGGTCTTGGCTCTTGG + Intergenic
1194218895 X:91167462-91167484 CAATTTCAGGACTTGACTCTTGG - Intergenic
1194229266 X:91301720-91301742 CAATTACAGAACTTGACTCTTGG + Intergenic
1194247450 X:91534018-91534040 TGATTCCAGGACTTGACTCTTGG - Intergenic
1194274799 X:91865938-91865960 CAATTCCAGGACACGACCCTTGG - Intronic
1194338696 X:92682253-92682275 TGATTTCAGGACTTGCCTCTTGG - Intergenic
1194361027 X:92950547-92950569 CAATTTCAGGACTTGGCTCTTGG - Intergenic
1194372493 X:93091165-93091187 TGACTCCAGGACTTGACTCTTGG - Intergenic
1194398221 X:93412322-93412344 CAAATCCAGACCCTGGCTCTTGG + Intergenic
1194415503 X:93606604-93606626 CAAGTCCAGGCCTTGGCTCTTGG + Intergenic
1194447150 X:94002264-94002286 CAATTCTATGACTTAACTCTAGG - Intergenic
1194479342 X:94401059-94401081 CAAGTCCAGGCTTAGGCTCTTGG - Intergenic
1194506754 X:94743159-94743181 GGATTCCAGGACTTGACTCTTGG - Intergenic
1194507606 X:94752160-94752182 CAATTCTAGGCCTTAGCTCCTGG - Intergenic
1194553513 X:95330486-95330508 CAATTTCAGGACTTGACTCTTGG - Intergenic
1194558620 X:95393740-95393762 CGATTCCAGGCCTTGACTCTTGG + Intergenic
1194591537 X:95805575-95805597 CAGTTCTAGGACTTGACTCATGG + Intergenic
1194595175 X:95848347-95848369 TGATTCCAGGACTTGACTCTTGG + Intergenic
1194605900 X:95977033-95977055 CAATTTCAGGACTTGACTCTTGG + Intergenic
1194626343 X:96230373-96230395 TGATTCCAGGCCTTGGCTCTTGG + Intergenic
1194692909 X:97009363-97009385 TGATTCCAGGCCTTGGCTCCTGG - Intronic
1194823424 X:98532315-98532337 CAATCCCAGGATGTGACTCTTGG + Intergenic
1194835094 X:98672288-98672310 TGATTCCAGGACTTGACTATTGG - Intergenic
1194839774 X:98726217-98726239 CAATTCTAAGACTTGACACTTGG - Intergenic
1194892264 X:99394692-99394714 CAAGTCCATGCCTAGGCTCTTGG - Intergenic
1194921954 X:99778268-99778290 TAATTCCAGGATTTGACTCTTGG - Intergenic
1194990730 X:100544012-100544034 AGATTCCAGGTCTTGGCTTTTGG + Intergenic
1195014644 X:100766262-100766284 TGATCCCAGGACTTGGCTCTTGG - Intergenic
1195172260 X:102281131-102281153 CAGTTCCAGGACTGGACTCTTGG - Intergenic
1195186600 X:102405962-102405984 CAGTTCCAGGACTGGACTCTTGG + Intronic
1195199310 X:102532643-102532665 CCATTCCAGGCCCTGGCTCCTGG + Intergenic
1195396158 X:104412529-104412551 CTATTCCAGGCCTTGTCTCTTGG + Intergenic
1195543316 X:106087510-106087532 TAATTCCAGGCCTTGCCACTTGG - Intergenic
1195595515 X:106683853-106683875 CAATCCCAGCCCTTGGCTCCTGG + Intergenic
1195823345 X:108970619-108970641 CAATTCCAGGCCTTGGCTCTTGG + Intergenic
1195834879 X:109102871-109102893 CTATTCCAGGACTTGACTCTTGG - Intergenic
1195852140 X:109295032-109295054 TGATTCCAGGACTTGACTCTTGG - Intergenic
1195917243 X:109947945-109947967 CAATTCCAGGGTGTGGCTCCTGG + Intergenic
1195971503 X:110478222-110478244 TGATTCTAGGACATGGCTCTTGG - Intergenic
1196096746 X:111808583-111808605 TGATCCCAGGCCTTGGCTCTTGG - Intronic
1196154042 X:112407209-112407231 CGATTCCAGGACTTGACCTTTGG + Intergenic
1196182117 X:112703788-112703810 CAATTCCAGGCCTAGGCTCTTGG - Intergenic
1196214496 X:113035003-113035025 CAATTCCAGGACTTGGCTCTTGG - Intergenic
1196248447 X:113428823-113428845 CAATTCCAGGCCTTGGCTCATGG + Intergenic
1196304665 X:114087240-114087262 TGATTCTAGGCCTTGGCTCTTGG + Intergenic
1196357327 X:114809711-114809733 CGGTTCCAGGCCTTGGTTCTTGG - Intronic
1196399533 X:115299729-115299751 TGATTCCAGGACTTGACTCTTGG - Intronic
1196479917 X:116135940-116135962 CAACTCCAGGCCTTGGCTCTTGG - Intergenic
1196508406 X:116476528-116476550 GGATTCCAGGACTTGAATCTTGG - Intergenic
1196512077 X:116523730-116523752 CAATTCCAGGCCTTGGCTCTTGG - Intergenic
1196529320 X:116765920-116765942 CAATTTCAGAATTTGGCTTTTGG + Intergenic
1196535414 X:116838136-116838158 TAGTTCCAGGACTTGACTCTTGG - Intergenic
1196537320 X:116862681-116862703 TGATTCCAGGACTTAGCTTTTGG - Intergenic
1196538945 X:116882611-116882633 CAGTTCCAGGACGTGACTCTTGG - Intergenic
1196588754 X:117460864-117460886 CAATTCCAGGAGTTGGCCCTTGG + Intergenic
1196590840 X:117484074-117484096 TGAGTCCAGGACTTGGCACTTGG + Intergenic
1196591045 X:117485404-117485426 CAATTTTAGGACTTGACTCTTGG - Intergenic
1196639256 X:118039292-118039314 CAATTCTAGGCCTTGACTCCTGG + Intronic
1196660537 X:118264399-118264421 CAATTCCAGGACCTGATACTTGG + Intergenic
1196922143 X:120595266-120595288 CAATTCTAGGACTTGATTCTTGG + Intronic
1196984526 X:121253740-121253762 TGATTCCAGTACTTGACTCTTGG - Intergenic
1197011603 X:121570817-121570839 TGATTCCAGGCCTTGGTTCTGGG + Intergenic
1197016005 X:121626948-121626970 CAATTCCAGGCCTTGGTTCCTGG + Intergenic
1197052545 X:122077342-122077364 CGATTCTAGGACTTAGCACTTGG - Intergenic
1197053921 X:122094329-122094351 GGATTCCAGGCCTTGGCTATTGG + Intergenic
1197139136 X:123096889-123096911 TCATTACAGGACTTGGCTCTTGG + Intergenic
1197348284 X:125350631-125350653 TATTTCCAGGACTTTACTCTTGG + Intergenic
1197361110 X:125504719-125504741 AAATTCTAGGCCTTGGCTCTTGG - Intergenic
1197380804 X:125736646-125736668 CTAAGCCAGGGCTTGGCTCTTGG - Intergenic
1197382742 X:125765588-125765610 TGAATCCAGGCCTTGGCTCTTGG - Intergenic
1197437998 X:126456159-126456181 TAATTCTAGGACTTTACTCTTGG + Intergenic
1197535909 X:127689273-127689295 CAATTCCAGGACTTGACTCTTGG - Intergenic
1197558879 X:127992655-127992677 CAGTTCCAGGATTTGGCTATTGG + Intergenic
1197600384 X:128520469-128520491 CAATTCAAGGATGTGGCTCTGGG + Intergenic
1197661516 X:129178870-129178892 CGATTCCAATACTTGGCTCTTGG - Intergenic
1197677628 X:129347241-129347263 CGATTCCAGGACTTGACTTCTGG + Intergenic
1198190497 X:134299645-134299667 TGATTCCAGGACTTGATTCTTGG + Intergenic
1198612006 X:138411841-138411863 CAATTCCAGGCTTTGGCGCTTGG + Intergenic
1198694882 X:139325156-139325178 TAATTCCAGGACTTGATTCTTGG + Intergenic
1198702553 X:139413710-139413732 CAGTTCTAGGACTTGGTTCTTGG - Intergenic
1198724655 X:139664609-139664631 TGATTCCAGGCCTTGCCTCTGGG - Intronic
1198818057 X:140614281-140614303 CAATTCTAGGACTTGACTCCTGG - Intergenic
1198927444 X:141814790-141814812 TAATTCCAGCACTTGTCTCTTGG - Intergenic
1198938893 X:141931388-141931410 CAATTCCAGGACTTGAATCTTGG - Intergenic
1198996703 X:142580758-142580780 CCATTCCAGGACCTAGCTCCTGG - Intergenic
1199005746 X:142693939-142693961 TGATTCCAGGCCATGGCTCTTGG + Intergenic
1199032260 X:143014090-143014112 TGATTTCAGGACTTGGCTCTTGG + Intergenic
1199036162 X:143053204-143053226 CTATTCCACGAGTTGTCTCTTGG - Intergenic
1199041072 X:143116088-143116110 CAGTTTCAGGACTTGACCCTTGG - Intergenic
1199076206 X:143529761-143529783 CAATTCCAGGACTTAACTCTTGG - Intergenic
1199135399 X:144244147-144244169 GAGGTCCAGGACATGGCTCTTGG + Intergenic
1199148310 X:144397562-144397584 TGATTTCAGGATTTGGCTCTTGG + Intergenic
1199239157 X:145526446-145526468 CAATTCCAGGACTTGACTCTTGG + Intergenic
1199259079 X:145749640-145749662 AATCTCCAGGACTTCGCTCTGGG + Intergenic
1199317313 X:146395742-146395764 CAATTCCAGAACTTGGGTCTTGG - Intergenic
1199455182 X:148020336-148020358 CAATCCCGGGCCTTGGCTGTTGG - Intronic
1199568764 X:149246391-149246413 CAATTCCAGGACTTGGCTCCTGG - Intergenic
1199645768 X:149909435-149909457 TAGTTCCAGGTCTTGGCACTTGG + Intergenic
1200364263 X:155644777-155644799 TGATTCTAGGCCTTGGCTCTTGG - Intronic
1200462896 Y:3479403-3479425 CAATTCCAGGCTTTGGCTCTTGG + Intergenic
1200467982 Y:3545397-3545419 CAGTTCTAGGACTGGGCTCTTGG - Intergenic
1200504184 Y:3992479-3992501 CAATTCCAGAACATGATTCTTGG - Intergenic
1200511348 Y:4083732-4083754 TGATCCCAGGACTTGACTCTTGG + Intergenic
1200555405 Y:4631218-4631240 CAATTTCAGGACTTGACTCTTGG - Intergenic
1200566473 Y:4775551-4775573 TGATTCCAGGACTTGACTCTTGG - Intergenic
1200592041 Y:5087339-5087361 CAATTCCAGGACACGACCCTTGG - Intronic
1200647086 Y:5799035-5799057 TGATTTCAGGACTTGCCTCTTGG - Intergenic
1200669224 Y:6066359-6066381 CAATTTCAGGACTTGGCTCTTGG - Intergenic
1200680534 Y:6205208-6205230 TGACTCCAGGACTTGACTCTTGG - Intergenic
1200719465 Y:6587539-6587561 AAATTTTAGGACTCGGCTCTTGG + Intergenic
1201372269 Y:13278453-13278475 CAATTTCAGGTGTTGGCACTTGG + Intronic
1202024099 Y:20501899-20501921 TGATTCCAAGACTTGACTCTTGG - Intergenic
1202042666 Y:20701487-20701509 TGATTTCAGGCCTTGGCTCTAGG + Intergenic