ID: 913710066

View in Genome Browser
Species Human (GRCh38)
Location 1:121473810-121473832
Sequence TCAAGGGCCCACAAATATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913710063_913710066 -2 Left 913710063 1:121473789-121473811 CCTAAATCATCTTTTTCAAGTTC No data
Right 913710066 1:121473810-121473832 TCAAGGGCCCACAAATATCTAGG No data
913710060_913710066 6 Left 913710060 1:121473781-121473803 CCAGATCCCCTAAATCATCTTTT No data
Right 913710066 1:121473810-121473832 TCAAGGGCCCACAAATATCTAGG No data
913710061_913710066 0 Left 913710061 1:121473787-121473809 CCCCTAAATCATCTTTTTCAAGT No data
Right 913710066 1:121473810-121473832 TCAAGGGCCCACAAATATCTAGG No data
913710062_913710066 -1 Left 913710062 1:121473788-121473810 CCCTAAATCATCTTTTTCAAGTT No data
Right 913710066 1:121473810-121473832 TCAAGGGCCCACAAATATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913710066 Original CRISPR TCAAGGGCCCACAAATATCT AGG Intergenic
No off target data available for this crispr