ID: 913710249

View in Genome Browser
Species Human (GRCh38)
Location 1:121475858-121475880
Sequence TCATGTTAACTGATGAATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913710249_913710253 -3 Left 913710249 1:121475858-121475880 CCCTGATTCATCAGTTAACATGA No data
Right 913710253 1:121475878-121475900 TGAAGAGAAAATGGGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913710249 Original CRISPR TCATGTTAACTGATGAATCA GGG (reversed) Intergenic
No off target data available for this crispr