ID: 913717340

View in Genome Browser
Species Human (GRCh38)
Location 1:121549968-121549990
Sequence GTTTCTACACAAATGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913717340_913717343 13 Left 913717340 1:121549968-121549990 CCTGGCTTCATTTGTGTAGAAAC No data
Right 913717343 1:121550004-121550026 TGGTATTTCTCTTTCTTTTGAGG 0: 2
1: 2
2: 2
3: 73
4: 768
913717340_913717341 -7 Left 913717340 1:121549968-121549990 CCTGGCTTCATTTGTGTAGAAAC No data
Right 913717341 1:121549984-121550006 TAGAAACCATTCACGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913717340 Original CRISPR GTTTCTACACAAATGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr