ID: 913717912

View in Genome Browser
Species Human (GRCh38)
Location 1:121557203-121557225
Sequence ATTGAGGAATAGAAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913717912_913717916 4 Left 913717912 1:121557203-121557225 CCTTCCTGCTTCTATTCCTCAAT No data
Right 913717916 1:121557230-121557252 AGCACAGGTTTTAGTTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913717912 Original CRISPR ATTGAGGAATAGAAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr