ID: 913728817

View in Genome Browser
Species Human (GRCh38)
Location 1:121686632-121686654
Sequence CACAAGGAAGTTCCTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913728815_913728817 16 Left 913728815 1:121686593-121686615 CCAAAGGAAAGTACATCTCTGTG No data
Right 913728817 1:121686632-121686654 CACAAGGAAGTTCCTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913728817 Original CRISPR CACAAGGAAGTTCCTGAGCA TGG Intergenic
No off target data available for this crispr