ID: 913742999

View in Genome Browser
Species Human (GRCh38)
Location 1:121870105-121870127
Sequence TTTTGGAGGCTTCCAGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913742999_913743011 3 Left 913742999 1:121870105-121870127 CCCAGCCCTGGAAGCCTCCAAAA No data
Right 913743011 1:121870131-121870153 CCCTTGGAATGTTGAAAAGGGGG No data
913742999_913743007 1 Left 913742999 1:121870105-121870127 CCCAGCCCTGGAAGCCTCCAAAA No data
Right 913743007 1:121870129-121870151 TCCCCTTGGAATGTTGAAAAGGG No data
913742999_913743006 0 Left 913742999 1:121870105-121870127 CCCAGCCCTGGAAGCCTCCAAAA No data
Right 913743006 1:121870128-121870150 TTCCCCTTGGAATGTTGAAAAGG No data
913742999_913743013 4 Left 913742999 1:121870105-121870127 CCCAGCCCTGGAAGCCTCCAAAA No data
Right 913743013 1:121870132-121870154 CCTTGGAATGTTGAAAAGGGGGG No data
913742999_913743009 2 Left 913742999 1:121870105-121870127 CCCAGCCCTGGAAGCCTCCAAAA No data
Right 913743009 1:121870130-121870152 CCCCTTGGAATGTTGAAAAGGGG No data
913742999_913743014 26 Left 913742999 1:121870105-121870127 CCCAGCCCTGGAAGCCTCCAAAA No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913742999 Original CRISPR TTTTGGAGGCTTCCAGGGCT GGG (reversed) Intergenic
No off target data available for this crispr