ID: 913743000

View in Genome Browser
Species Human (GRCh38)
Location 1:121870106-121870128
Sequence ATTTTGGAGGCTTCCAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913743000_913743011 2 Left 913743000 1:121870106-121870128 CCAGCCCTGGAAGCCTCCAAAAT No data
Right 913743011 1:121870131-121870153 CCCTTGGAATGTTGAAAAGGGGG No data
913743000_913743007 0 Left 913743000 1:121870106-121870128 CCAGCCCTGGAAGCCTCCAAAAT No data
Right 913743007 1:121870129-121870151 TCCCCTTGGAATGTTGAAAAGGG No data
913743000_913743014 25 Left 913743000 1:121870106-121870128 CCAGCCCTGGAAGCCTCCAAAAT No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913743000_913743006 -1 Left 913743000 1:121870106-121870128 CCAGCCCTGGAAGCCTCCAAAAT No data
Right 913743006 1:121870128-121870150 TTCCCCTTGGAATGTTGAAAAGG No data
913743000_913743009 1 Left 913743000 1:121870106-121870128 CCAGCCCTGGAAGCCTCCAAAAT No data
Right 913743009 1:121870130-121870152 CCCCTTGGAATGTTGAAAAGGGG No data
913743000_913743013 3 Left 913743000 1:121870106-121870128 CCAGCCCTGGAAGCCTCCAAAAT No data
Right 913743013 1:121870132-121870154 CCTTGGAATGTTGAAAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913743000 Original CRISPR ATTTTGGAGGCTTCCAGGGC TGG (reversed) Intergenic
No off target data available for this crispr