ID: 913743004

View in Genome Browser
Species Human (GRCh38)
Location 1:121870119-121870141
Sequence CATTCCAAGGGGAATTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913743004_913743019 29 Left 913743004 1:121870119-121870141 CCTCCAAAATTCCCCTTGGAATG No data
Right 913743019 1:121870171-121870193 AAAAGGAAAGTCCATCTTGGGGG No data
913743004_913743017 27 Left 913743004 1:121870119-121870141 CCTCCAAAATTCCCCTTGGAATG No data
Right 913743017 1:121870169-121870191 TCAAAAGGAAAGTCCATCTTGGG No data
913743004_913743018 28 Left 913743004 1:121870119-121870141 CCTCCAAAATTCCCCTTGGAATG No data
Right 913743018 1:121870170-121870192 CAAAAGGAAAGTCCATCTTGGGG No data
913743004_913743016 26 Left 913743004 1:121870119-121870141 CCTCCAAAATTCCCCTTGGAATG No data
Right 913743016 1:121870168-121870190 TTCAAAAGGAAAGTCCATCTTGG No data
913743004_913743014 12 Left 913743004 1:121870119-121870141 CCTCCAAAATTCCCCTTGGAATG No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913743004_913743013 -10 Left 913743004 1:121870119-121870141 CCTCCAAAATTCCCCTTGGAATG No data
Right 913743013 1:121870132-121870154 CCTTGGAATGTTGAAAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913743004 Original CRISPR CATTCCAAGGGGAATTTTGG AGG (reversed) Intergenic
No off target data available for this crispr