ID: 913743009

View in Genome Browser
Species Human (GRCh38)
Location 1:121870130-121870152
Sequence CCCCTTGGAATGTTGAAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913742999_913743009 2 Left 913742999 1:121870105-121870127 CCCAGCCCTGGAAGCCTCCAAAA No data
Right 913743009 1:121870130-121870152 CCCCTTGGAATGTTGAAAAGGGG No data
913743001_913743009 -3 Left 913743001 1:121870110-121870132 CCCTGGAAGCCTCCAAAATTCCC No data
Right 913743009 1:121870130-121870152 CCCCTTGGAATGTTGAAAAGGGG No data
913743002_913743009 -4 Left 913743002 1:121870111-121870133 CCTGGAAGCCTCCAAAATTCCCC No data
Right 913743009 1:121870130-121870152 CCCCTTGGAATGTTGAAAAGGGG No data
913743000_913743009 1 Left 913743000 1:121870106-121870128 CCAGCCCTGGAAGCCTCCAAAAT No data
Right 913743009 1:121870130-121870152 CCCCTTGGAATGTTGAAAAGGGG No data
913742998_913743009 3 Left 913742998 1:121870104-121870126 CCCCAGCCCTGGAAGCCTCCAAA No data
Right 913743009 1:121870130-121870152 CCCCTTGGAATGTTGAAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913743009 Original CRISPR CCCCTTGGAATGTTGAAAAG GGG Intergenic
No off target data available for this crispr