ID: 913743014

View in Genome Browser
Species Human (GRCh38)
Location 1:121870154-121870176
Sequence GTTCCAAGCTGTTTTTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913743000_913743014 25 Left 913743000 1:121870106-121870128 CCAGCCCTGGAAGCCTCCAAAAT No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913743001_913743014 21 Left 913743001 1:121870110-121870132 CCCTGGAAGCCTCCAAAATTCCC No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913742998_913743014 27 Left 913742998 1:121870104-121870126 CCCCAGCCCTGGAAGCCTCCAAA No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913742999_913743014 26 Left 913742999 1:121870105-121870127 CCCAGCCCTGGAAGCCTCCAAAA No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913743002_913743014 20 Left 913743002 1:121870111-121870133 CCTGGAAGCCTCCAAAATTCCCC No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913743005_913743014 9 Left 913743005 1:121870122-121870144 CCAAAATTCCCCTTGGAATGTTG No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913743012_913743014 -1 Left 913743012 1:121870132-121870154 CCTTGGAATGTTGAAAAGGGGGG No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913743010_913743014 0 Left 913743010 1:121870131-121870153 CCCTTGGAATGTTGAAAAGGGGG No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913743004_913743014 12 Left 913743004 1:121870119-121870141 CCTCCAAAATTCCCCTTGGAATG No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data
913743008_913743014 1 Left 913743008 1:121870130-121870152 CCCCTTGGAATGTTGAAAAGGGG No data
Right 913743014 1:121870154-121870176 GTTCCAAGCTGTTTTTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913743014 Original CRISPR GTTCCAAGCTGTTTTTCAAA AGG Intergenic
No off target data available for this crispr