ID: 913743017

View in Genome Browser
Species Human (GRCh38)
Location 1:121870169-121870191
Sequence TCAAAAGGAAAGTCCATCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913743005_913743017 24 Left 913743005 1:121870122-121870144 CCAAAATTCCCCTTGGAATGTTG No data
Right 913743017 1:121870169-121870191 TCAAAAGGAAAGTCCATCTTGGG No data
913743012_913743017 14 Left 913743012 1:121870132-121870154 CCTTGGAATGTTGAAAAGGGGGG No data
Right 913743017 1:121870169-121870191 TCAAAAGGAAAGTCCATCTTGGG No data
913743008_913743017 16 Left 913743008 1:121870130-121870152 CCCCTTGGAATGTTGAAAAGGGG No data
Right 913743017 1:121870169-121870191 TCAAAAGGAAAGTCCATCTTGGG No data
913743004_913743017 27 Left 913743004 1:121870119-121870141 CCTCCAAAATTCCCCTTGGAATG No data
Right 913743017 1:121870169-121870191 TCAAAAGGAAAGTCCATCTTGGG No data
913743010_913743017 15 Left 913743010 1:121870131-121870153 CCCTTGGAATGTTGAAAAGGGGG No data
Right 913743017 1:121870169-121870191 TCAAAAGGAAAGTCCATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913743017 Original CRISPR TCAAAAGGAAAGTCCATCTT GGG Intergenic
No off target data available for this crispr