ID: 913743019

View in Genome Browser
Species Human (GRCh38)
Location 1:121870171-121870193
Sequence AAAAGGAAAGTCCATCTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913743008_913743019 18 Left 913743008 1:121870130-121870152 CCCCTTGGAATGTTGAAAAGGGG No data
Right 913743019 1:121870171-121870193 AAAAGGAAAGTCCATCTTGGGGG No data
913743004_913743019 29 Left 913743004 1:121870119-121870141 CCTCCAAAATTCCCCTTGGAATG No data
Right 913743019 1:121870171-121870193 AAAAGGAAAGTCCATCTTGGGGG No data
913743015_913743019 -9 Left 913743015 1:121870157-121870179 CCAAGCTGTTTTTCAAAAGGAAA No data
Right 913743019 1:121870171-121870193 AAAAGGAAAGTCCATCTTGGGGG No data
913743010_913743019 17 Left 913743010 1:121870131-121870153 CCCTTGGAATGTTGAAAAGGGGG No data
Right 913743019 1:121870171-121870193 AAAAGGAAAGTCCATCTTGGGGG No data
913743005_913743019 26 Left 913743005 1:121870122-121870144 CCAAAATTCCCCTTGGAATGTTG No data
Right 913743019 1:121870171-121870193 AAAAGGAAAGTCCATCTTGGGGG No data
913743012_913743019 16 Left 913743012 1:121870132-121870154 CCTTGGAATGTTGAAAAGGGGGG No data
Right 913743019 1:121870171-121870193 AAAAGGAAAGTCCATCTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913743019 Original CRISPR AAAAGGAAAGTCCATCTTGG GGG Intergenic
No off target data available for this crispr