ID: 913748384

View in Genome Browser
Species Human (GRCh38)
Location 1:121933021-121933043
Sequence CACAGAGATGTACTTTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913748384_913748386 16 Left 913748384 1:121933021-121933043 CCAAAGGAAAGTACATCTCTGTG No data
Right 913748386 1:121933060-121933082 CACAAGGAAGTTCCTGAGCATGG No data
913748384_913748385 0 Left 913748384 1:121933021-121933043 CCAAAGGAAAGTACATCTCTGTG No data
Right 913748385 1:121933044-121933066 AGTTGAATACAAACGTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913748384 Original CRISPR CACAGAGATGTACTTTCCTT TGG (reversed) Intergenic
No off target data available for this crispr