ID: 913748386

View in Genome Browser
Species Human (GRCh38)
Location 1:121933060-121933082
Sequence CACAAGGAAGTTCCTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913748384_913748386 16 Left 913748384 1:121933021-121933043 CCAAAGGAAAGTACATCTCTGTG No data
Right 913748386 1:121933060-121933082 CACAAGGAAGTTCCTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913748386 Original CRISPR CACAAGGAAGTTCCTGAGCA TGG Intergenic
No off target data available for this crispr