ID: 913749796

View in Genome Browser
Species Human (GRCh38)
Location 1:121950427-121950449
Sequence AATTTCCCTTTTCAGATCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913749794_913749796 -10 Left 913749794 1:121950414-121950436 CCTCAAACGTTCCAATTTCCCTT No data
Right 913749796 1:121950427-121950449 AATTTCCCTTTTCAGATCTACGG No data
913749793_913749796 -4 Left 913749793 1:121950408-121950430 CCATAGCCTCAAACGTTCCAATT No data
Right 913749796 1:121950427-121950449 AATTTCCCTTTTCAGATCTACGG No data
913749792_913749796 4 Left 913749792 1:121950400-121950422 CCTCTACGCCATAGCCTCAAACG No data
Right 913749796 1:121950427-121950449 AATTTCCCTTTTCAGATCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913749796 Original CRISPR AATTTCCCTTTTCAGATCTA CGG Intergenic
No off target data available for this crispr