ID: 913957638

View in Genome Browser
Species Human (GRCh38)
Location 1:143319358-143319380
Sequence AGATGGACTTGGAGGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913957638_913957644 -2 Left 913957638 1:143319358-143319380 CCAGGACACCTCCAAGTCCATCT No data
Right 913957644 1:143319379-143319401 CTCTGGCCCTGCCTTGGCCCTGG No data
913957638_913957654 26 Left 913957638 1:143319358-143319380 CCAGGACACCTCCAAGTCCATCT No data
Right 913957654 1:143319407-143319429 TCCTGGCCTGACCTTGTCCCTGG No data
913957638_913957648 9 Left 913957638 1:143319358-143319380 CCAGGACACCTCCAAGTCCATCT No data
Right 913957648 1:143319390-143319412 CCTTGGCCCTGGCCCCTTCCTGG No data
913957638_913957642 -8 Left 913957638 1:143319358-143319380 CCAGGACACCTCCAAGTCCATCT No data
Right 913957642 1:143319373-143319395 GTCCATCTCTGGCCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913957638 Original CRISPR AGATGGACTTGGAGGTGTCC TGG (reversed) Intergenic
No off target data available for this crispr