ID: 913957639

View in Genome Browser
Species Human (GRCh38)
Location 1:143319362-143319384
Sequence GACACCTCCAAGTCCATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913957636_913957639 7 Left 913957636 1:143319332-143319354 CCAACGTTGGGGCAGGGCAAATC No data
Right 913957639 1:143319362-143319384 GACACCTCCAAGTCCATCTCTGG No data
913957630_913957639 23 Left 913957630 1:143319316-143319338 CCAGAGCAGGGCTGGACCAACGT No data
Right 913957639 1:143319362-143319384 GACACCTCCAAGTCCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913957639 Original CRISPR GACACCTCCAAGTCCATCTC TGG Intergenic
No off target data available for this crispr