ID: 913957640

View in Genome Browser
Species Human (GRCh38)
Location 1:143319366-143319388
Sequence AGGGCCAGAGATGGACTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913957640_913957648 1 Left 913957640 1:143319366-143319388 CCTCCAAGTCCATCTCTGGCCCT No data
Right 913957648 1:143319390-143319412 CCTTGGCCCTGGCCCCTTCCTGG No data
913957640_913957654 18 Left 913957640 1:143319366-143319388 CCTCCAAGTCCATCTCTGGCCCT No data
Right 913957654 1:143319407-143319429 TCCTGGCCTGACCTTGTCCCTGG No data
913957640_913957644 -10 Left 913957640 1:143319366-143319388 CCTCCAAGTCCATCTCTGGCCCT No data
Right 913957644 1:143319379-143319401 CTCTGGCCCTGCCTTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913957640 Original CRISPR AGGGCCAGAGATGGACTTGG AGG (reversed) Intergenic
No off target data available for this crispr