ID: 913957644

View in Genome Browser
Species Human (GRCh38)
Location 1:143319379-143319401
Sequence CTCTGGCCCTGCCTTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913957640_913957644 -10 Left 913957640 1:143319366-143319388 CCTCCAAGTCCATCTCTGGCCCT No data
Right 913957644 1:143319379-143319401 CTCTGGCCCTGCCTTGGCCCTGG No data
913957636_913957644 24 Left 913957636 1:143319332-143319354 CCAACGTTGGGGCAGGGCAAATC No data
Right 913957644 1:143319379-143319401 CTCTGGCCCTGCCTTGGCCCTGG No data
913957638_913957644 -2 Left 913957638 1:143319358-143319380 CCAGGACACCTCCAAGTCCATCT No data
Right 913957644 1:143319379-143319401 CTCTGGCCCTGCCTTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913957644 Original CRISPR CTCTGGCCCTGCCTTGGCCC TGG Intergenic
No off target data available for this crispr