ID: 913960044

View in Genome Browser
Species Human (GRCh38)
Location 1:143332517-143332539
Sequence GCTCCTGGCAAGGCACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913960044_913960051 29 Left 913960044 1:143332517-143332539 CCTGGTTGTGCCTTGCCAGGAGC No data
Right 913960051 1:143332569-143332591 GCGCAGCAGTGGTAGTTGTGTGG No data
913960044_913960050 18 Left 913960044 1:143332517-143332539 CCTGGTTGTGCCTTGCCAGGAGC No data
Right 913960050 1:143332558-143332580 GAGTGTCATGAGCGCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913960044 Original CRISPR GCTCCTGGCAAGGCACAACC AGG (reversed) Intergenic
No off target data available for this crispr