ID: 913962904

View in Genome Browser
Species Human (GRCh38)
Location 1:143353532-143353554
Sequence GTTCCCCAACGGAGACCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913962892_913962904 26 Left 913962892 1:143353483-143353505 CCATCGGACGCTCGGACACGGAC No data
Right 913962904 1:143353532-143353554 GTTCCCCAACGGAGACCCTCGGG No data
913962897_913962904 3 Left 913962897 1:143353506-143353528 CCAGGCAGGATCACCTGGACCTC No data
Right 913962904 1:143353532-143353554 GTTCCCCAACGGAGACCCTCGGG No data
913962896_913962904 4 Left 913962896 1:143353505-143353527 CCCAGGCAGGATCACCTGGACCT No data
Right 913962904 1:143353532-143353554 GTTCCCCAACGGAGACCCTCGGG No data
913962900_913962904 -10 Left 913962900 1:143353519-143353541 CCTGGACCTCTGGGTTCCCCAAC No data
Right 913962904 1:143353532-143353554 GTTCCCCAACGGAGACCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913962904 Original CRISPR GTTCCCCAACGGAGACCCTC GGG Intergenic
No off target data available for this crispr