ID: 913967326

View in Genome Browser
Species Human (GRCh38)
Location 1:143387889-143387911
Sequence CAGCCCGAAGACTTTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913967326_913967331 7 Left 913967326 1:143387889-143387911 CCCACCACAAAGTCTTCGGGCTG No data
Right 913967331 1:143387919-143387941 ATGGTGCTGAGGTAATCTAGAGG No data
913967326_913967330 -4 Left 913967326 1:143387889-143387911 CCCACCACAAAGTCTTCGGGCTG No data
Right 913967330 1:143387908-143387930 GCTGATTGTCAATGGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913967326 Original CRISPR CAGCCCGAAGACTTTGTGGT GGG (reversed) Intergenic
No off target data available for this crispr