ID: 913968241

View in Genome Browser
Species Human (GRCh38)
Location 1:143394383-143394405
Sequence ATGTTGTCATTGTTCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913968235_913968241 24 Left 913968235 1:143394336-143394358 CCCTGGAGCCACCTTCCTCTGGA No data
Right 913968241 1:143394383-143394405 ATGTTGTCATTGTTCAAGCCAGG No data
913968238_913968241 13 Left 913968238 1:143394347-143394369 CCTTCCTCTGGAGTTCTTGTGAT No data
Right 913968241 1:143394383-143394405 ATGTTGTCATTGTTCAAGCCAGG No data
913968237_913968241 16 Left 913968237 1:143394344-143394366 CCACCTTCCTCTGGAGTTCTTGT No data
Right 913968241 1:143394383-143394405 ATGTTGTCATTGTTCAAGCCAGG No data
913968240_913968241 9 Left 913968240 1:143394351-143394373 CCTCTGGAGTTCTTGTGATGGCA No data
Right 913968241 1:143394383-143394405 ATGTTGTCATTGTTCAAGCCAGG No data
913968236_913968241 23 Left 913968236 1:143394337-143394359 CCTGGAGCCACCTTCCTCTGGAG No data
Right 913968241 1:143394383-143394405 ATGTTGTCATTGTTCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913968241 Original CRISPR ATGTTGTCATTGTTCAAGCC AGG Intergenic
No off target data available for this crispr