ID: 913970723

View in Genome Browser
Species Human (GRCh38)
Location 1:143413776-143413798
Sequence CTGTCTGCACAGTTGGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913970723_913970725 -4 Left 913970723 1:143413776-143413798 CCTAGGACCAACTGTGCAGACAG No data
Right 913970725 1:143413795-143413817 ACAGACAGACCCTCCTTCACAGG 0: 6
1: 0
2: 2
3: 22
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913970723 Original CRISPR CTGTCTGCACAGTTGGTCCT AGG (reversed) Intergenic
No off target data available for this crispr