ID: 913971985

View in Genome Browser
Species Human (GRCh38)
Location 1:143423063-143423085
Sequence CTGCCTGTGGCACAACCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913971985_913971992 -8 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913971992 1:143423078-143423100 ACAGGCAGGGGTCCTGCCCCAGG No data
913971985_913972007 20 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913972007 1:143423106-143423128 GGTAGTCCGGGGGAGCTCGAGGG No data
913971985_913971995 -3 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913971995 1:143423083-143423105 CAGGGGTCCTGCCCCAGGGAGGG No data
913971985_913971994 -4 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913971994 1:143423082-143423104 GCAGGGGTCCTGCCCCAGGGAGG No data
913971985_913971993 -7 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913971993 1:143423079-143423101 CAGGCAGGGGTCCTGCCCCAGGG No data
913971985_913972001 8 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
913971985_913971997 -1 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913971997 1:143423085-143423107 GGGGTCCTGCCCCAGGGAGGGGG No data
913971985_913971996 -2 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913971996 1:143423084-143423106 AGGGGTCCTGCCCCAGGGAGGGG No data
913971985_913971999 7 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913971999 1:143423093-143423115 GCCCCAGGGAGGGGGTAGTCCGG No data
913971985_913972003 9 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913972003 1:143423095-143423117 CCCAGGGAGGGGGTAGTCCGGGG No data
913971985_913972006 19 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913972006 1:143423105-143423127 GGGTAGTCCGGGGGAGCTCGAGG No data
913971985_913972005 10 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913972005 1:143423096-143423118 CCAGGGAGGGGGTAGTCCGGGGG No data
913971985_913972008 25 Left 913971985 1:143423063-143423085 CCCCTTGGTTGTGCCACAGGCAG No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913971985 Original CRISPR CTGCCTGTGGCACAACCAAG GGG (reversed) Intergenic
No off target data available for this crispr