ID: 913971986

View in Genome Browser
Species Human (GRCh38)
Location 1:143423064-143423086
Sequence CCTGCCTGTGGCACAACCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913971986_913972007 19 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972007 1:143423106-143423128 GGTAGTCCGGGGGAGCTCGAGGG No data
913971986_913972008 24 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913971986_913972001 7 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
913971986_913972005 9 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972005 1:143423096-143423118 CCAGGGAGGGGGTAGTCCGGGGG No data
913971986_913972010 30 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data
913971986_913971993 -8 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913971993 1:143423079-143423101 CAGGCAGGGGTCCTGCCCCAGGG No data
913971986_913971997 -2 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913971997 1:143423085-143423107 GGGGTCCTGCCCCAGGGAGGGGG No data
913971986_913972003 8 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972003 1:143423095-143423117 CCCAGGGAGGGGGTAGTCCGGGG No data
913971986_913971994 -5 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913971994 1:143423082-143423104 GCAGGGGTCCTGCCCCAGGGAGG No data
913971986_913971992 -9 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913971992 1:143423078-143423100 ACAGGCAGGGGTCCTGCCCCAGG No data
913971986_913972006 18 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913972006 1:143423105-143423127 GGGTAGTCCGGGGGAGCTCGAGG No data
913971986_913971996 -3 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913971996 1:143423084-143423106 AGGGGTCCTGCCCCAGGGAGGGG No data
913971986_913971995 -4 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913971995 1:143423083-143423105 CAGGGGTCCTGCCCCAGGGAGGG No data
913971986_913971999 6 Left 913971986 1:143423064-143423086 CCCTTGGTTGTGCCACAGGCAGG No data
Right 913971999 1:143423093-143423115 GCCCCAGGGAGGGGGTAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913971986 Original CRISPR CCTGCCTGTGGCACAACCAA GGG (reversed) Intergenic
No off target data available for this crispr