ID: 913971991

View in Genome Browser
Species Human (GRCh38)
Location 1:143423076-143423098
Sequence TGGGGCAGGACCCCTGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913971991_913972003 -4 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972003 1:143423095-143423117 CCCAGGGAGGGGGTAGTCCGGGG No data
913971991_913972005 -3 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972005 1:143423096-143423118 CCAGGGAGGGGGTAGTCCGGGGG No data
913971991_913972001 -5 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972001 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
913971991_913971999 -6 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913971999 1:143423093-143423115 GCCCCAGGGAGGGGGTAGTCCGG No data
913971991_913972007 7 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972007 1:143423106-143423128 GGTAGTCCGGGGGAGCTCGAGGG No data
913971991_913972008 12 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913971991_913972006 6 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972006 1:143423105-143423127 GGGTAGTCCGGGGGAGCTCGAGG No data
913971991_913972010 18 Left 913971991 1:143423076-143423098 CCACAGGCAGGGGTCCTGCCCCA No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913971991 Original CRISPR TGGGGCAGGACCCCTGCCTG TGG (reversed) Intergenic
No off target data available for this crispr