ID: 913971998

View in Genome Browser
Species Human (GRCh38)
Location 1:143423090-143423112
Sequence GACTACCCCCTCCCTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913971998_913972008 -2 Left 913971998 1:143423090-143423112 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913971998_913972011 25 Left 913971998 1:143423090-143423112 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 913972011 1:143423138-143423160 GGCCAGCTGTCACTCCTCCCTGG No data
913971998_913972013 30 Left 913971998 1:143423090-143423112 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 913972013 1:143423143-143423165 GCTGTCACTCCTCCCTGGAGAGG No data
913971998_913972007 -7 Left 913971998 1:143423090-143423112 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 913972007 1:143423106-143423128 GGTAGTCCGGGGGAGCTCGAGGG No data
913971998_913972010 4 Left 913971998 1:143423090-143423112 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data
913971998_913972006 -8 Left 913971998 1:143423090-143423112 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 913972006 1:143423105-143423127 GGGTAGTCCGGGGGAGCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913971998 Original CRISPR GACTACCCCCTCCCTGGGGC AGG (reversed) Intergenic
No off target data available for this crispr