ID: 913972000

View in Genome Browser
Species Human (GRCh38)
Location 1:143423094-143423116
Sequence CCCGGACTACCCCCTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
913972000_913972013 26 Left 913972000 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
Right 913972013 1:143423143-143423165 GCTGTCACTCCTCCCTGGAGAGG No data
913972000_913972008 -6 Left 913972000 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
Right 913972008 1:143423111-143423133 TCCGGGGGAGCTCGAGGGTGTGG No data
913972000_913972011 21 Left 913972000 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
Right 913972011 1:143423138-143423160 GGCCAGCTGTCACTCCTCCCTGG No data
913972000_913972010 0 Left 913972000 1:143423094-143423116 CCCCAGGGAGGGGGTAGTCCGGG No data
Right 913972010 1:143423117-143423139 GGAGCTCGAGGGTGTGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
913972000 Original CRISPR CCCGGACTACCCCCTCCCTG GGG (reversed) Intergenic
No off target data available for this crispr